Sunday, March 8, 2009

Sunday Solution

Seems as though there are no takers to solve the puzzle! I hope it was fun if you tried it.

On Friday I introduced the Kozak Consensus Sequence as a way to make the message decryption a bit more interesting. The sequence I provided for section one purposely had a bunch of "start" codons, ATG, to throw you off as you had to find the one ATG with a high strength Kozak. The best Kozak is the three bases ACC before the start codon ATG. So you wanted to find the section that started ACCATG to begin the message with your codon map.

The sequence:
5'-AAGGAATGACACTCTGGAAATGACAGCACCCG
GATTGGATGCCCTGTACTCCAGCGCGTCTCGGAG
CCACCATGACACATGAGTGGATTAATAACATCA
ATGGTGATATCGGCATAACGTCCGCCAGGGAA-3'

only had one ACCATG so that is where the first section begins and so the complete message is:
ACCATGACACATGAGTGGATTAATAACATCA
ATGGTGATATCGGCATAACGTCCGCCAGGGAA
remember the start M is not part of the message!

translated we have:
ACA-CAT-GAG
T-----H-----E

TGG-ATT-AAT-AAC-ATC-AAT-GGT
W-----I-----N------N-----I-----N-----G

GAT-ATC-GGC-ATA-ACG-TCC
D-----I------G-----I-----T----S

GCC-AGG-GAA
A-----R-----E

THE WINNING DIGITS ARE

In section two the only trick was to strip out the intronic regions, reassemble the message, and then translate it:

5'-GAGATTattcgggggcccttttaaacgGGACATACAAACAtgg
ggcccccgtggctTCAAccccaaaattttgggtgtgaatgcTGAAACTGggt
taaggccttaagggcgtAGAATTGAggccttaagcgcgctta-3'

taking out the small lettered introns:
GAGATTGGACATACAAACATCAATGAAACTGAGAATTGA

and I stated that the message picks right up from section one, so translated we have:

GAG-ATT-GGA-CAT-ACA
E------I-----G-----H----T

AAC-ATC-AAT-GAA
N------I-----N----E

ACT-GAG-AAT-TGA
T-----E-----N-----STOP

EIGHT NINE TEN

So if you add the numbers up, 8+9+10=27 would have been the correct solution!

Sorry if this was annoying and not fun.

Have a good night.

5 comments:

Lisa said...

I can't begin to tell you how badly I messed that up! LOL I'm willing to give it another go, if you're willing to do another puzzle next week. There's no doubt in my mind that you are WAY smarter than I am :)
Thanks!

watchtower said...

GYSC
I have to know, is the following paragraph from the Wiki site the place where we should have picked up on the ACC?

"The A nucleotide of the "AUG" is referred to as number 1. For a 'strong' consensus, the nucleotides at positions +4 (i.e. G in the consensus) and -3 (i.e. either A or G in the consensus) relative to the number 1 nucleotide must both match the consensus (there is no number 0 position). An 'adequate' consensus has only 1 of these sites, while a 'weak' consensus has neither. The cc at -1 and -2 are not as conserved, but contribute to the overall strength."

Also I am curious about last weeks puzzle where TTT is translated into "F" (i.e. the F in Friday), where is this located?
Am I overlooking it in the RNA codon table?

getyourselfconnected said...

Watchtower,
the + or- base spots denote where an element is relative to the ATG, so if ATG the A is the reference point and the A of the ACC kozak is -3 spot.

TTT on the table is UUU, as RNA uses another base called uracil and not the T from DNA but I tried to make it less complex!

Take care!

watchtower said...

I would love to say "now I get it" but I would be lying : )

Anonymous said...

Not to sound odd but the whole gene sequencing thing aint my cup of tea...

G

Ps: BEZZEL.