Friday, April 23, 2010

On Vacation

Wrapped up things at work and all that is left is to get things set up for the trip! I need to cut the lawn tomorrow and do about a million other things before Sunday. I am a poor traveller and I always get a little frayed near a trip. We shall see how it goes!

Now I want you all to try your best to get along while I am away. I will return so do not miss me too much. There, there, don't be upset. It is only a week, I shall return!

When and How I was Wrong
Every now and again one of the Anon posters (the same one I think) leaves a comment that has very good long term thinking and a different take on things than me. Here is his comment from last post (slightly edited by the blogger spell check, I didn't change anything but some spelling):
"I have been so wrong on so many things. I admit that. It happens. I guess I figured people could think, but they just believe. Huge difference. Huge."

Happens every time - and oh so predictable. If I have said it once, I've said it 1,000 times.

THE U.S. WILL EVENTUALLY IMPLODE.

Of this I have no doubt. The issue however is the "eventually" part of that statement that gets you into trouble.

Your assumption was this is "it"... this is the "big one". This is the one that armchair spectators have expected to see out of the U.S. for the last oh 135 years.

IMO, its incredibly arrogant to assume while all those others and all those other crisis's were wrong, you and your call will be right.

Seldom before have have so many of the world's resources been concentrated into one sovereign. The Roman Empire, the Ancient Greeks, the British Empire, who else?

If history is any guide, large sovereigns flicker out at about 600-1,000 years. We are at 275+ and counting. Thus, given how the others fared, (not to mention the fact that the Brits are still here), we very well could not see the "big one" in our lifetimes.

So, as to when the big "it" happens? I lay even odds it will happen in my lifetime (next 50 years). Ive been told this is quite aggressive, but then again I am a pessimist.

Anyhoo, as much as I really thought this could be the big one, by Nov, 2008 I realized, this wasn't it. Thus, since then, I sat back and cautiously went long. Next window of opportunity for the big one is probably in 2-5 years as this cycle comes to a close. Will it be the big one? Probably not, but I guess we shall see wont we?

Til then, just sit back and try to enjoy life. Others have spent their entire lives watching, waiting for the "big one" they just knew was coming. They are all dead now.

To be fair, I never said this was "The Big One" or the "End of the US World". Actually I have always argued that the collapse that was in full swing would have been very rough, but we would have fought our way out and been much better off long term, and maybe even a bit better as soon as now. Still, that is splitting hairs as most of my commentary does carry that heavy duty "gloom and doom" angle, so I think Anon is about right.

Anon figured things would be ok (in his view) by November 2008. I did not. I recently have swung around to the belief that the greatest scam and the largest government intervention ever may well have brought about a statistical recovery and bought enough time for extend and pretend to have a fair chance at winning out. I am hard to convince!

I do not want to debate the particulars, I am half way out the door to the Bahamas as is, but let me say that while I think things are far worse than what is the mainstream belief, things are also not so bad as to cause any more concern or uproar than we have seen. Things are moving on.

It is this fact that pains me the most. There was a real shot a real change. The status quo now will be maintained because nobody cares enough anymore to do anything about it. That's last years news. This makes me sad.

Vacation Send Off Party
Enough heavy stuff! It is fun time!

Regular reader and contributor over at The Illusion of Prosperity blog Mab stopped by to wish me a good vacation. Thanks Mab! Mab does not stop here often, what's wrong with my blog? Does my blog stink? Anyways this was left in the comments:
GYSC,

Enjoy the vacation. Knock back a few cold ones me!

|^^^^^^^^^^^| ||-----/
|...BEER TRUCK.......| ||'|";, ____.
|......_______===|=||_|__|..., .. ] -
"(@)'(@)"""''"**|(@)(@)*****''(@)

Love it! I said:
Mab,
WOWZA! That is the coolest thing I have ever seen!!!!!!
Thanks!
The Bahamian beer, Kalik, will be under serious supply pressure, I suggest everyone goes LONG the stock, HA!

While beer will be large part of my vacation diet, they also make a drink called "Miami Vice" which is 1/2 pina colada and 1/2 strawberry daiquiri with plenty of coconut rum. All inclusive resort with unlimited booze, that just sounds nice.

Great Photo
I have one book for the vacation reading list: "Hands of Stone" by Christian Giudice. It is a Roberto Duran biography. While trolling the Internet I stumbled upon Marvelous Marvin Hagler's own site and found this great picture there:

This photo is of my two most beloved fighters of all time:
Marvelous Marvin Hagler
Alexis Arguello
Great picture!

Funny Pictures
Visual comedy!

I am sure it is just apple juice....


I should arrange for some flowers for the wife on the 6 year Anniversary:
funny pictures of cats with captions
see more Lolcats and funny pictures
CUTE!

Film Trailer
One of my favorite books was originally titled "Bid Time Return" by Richard Matheson. Sometimes when a book is translated into film it can be, well, bad. The film version named "Somewhere in Time" is an excellent adaptation and features Christopher Reeve in his finest screen performance. Check out the trailer and then get the movie!:

I am a sap, so what? Want to go 10 rounds?????

Rock Blogging
The last show for a bit. Enjoy the ride!

The second place finisher for the DNA puzzle was reader TS. TS requested a discussion on human evolution and whether it is happening in recent times. I have put together a few scraps since his request but i just ran out of time to get it together. I aim to deliver when I return.

Leading off the night is the music request of first place finisher Au Soleil Levant who asked for Stevie Nicks and "Edge of Seventeen". Now I have no idea if she knows my (and several readers here) life long love affair with Mrs. Disconnect, I mean Nicks, but this song is easy to play. Plus I found a kick ass live version!:

And yes Soleil, you do ROCK!

Last week Gawains brought the performance of "I Want It All" at a Freddy Mercury tribute concert done with Roger Daltrey and Tony Iommi. It really is special and I had never heard it:

Thanks man!

Loyal reader Lurker wanted the Rocky theme, but that will just make me want to work out and it is my night off! As a back up we have Bachman Turner Overdrive and "Taking Care of Business":

Very good stuff.

I love the singer Jewel (where has she been?) and any time she is live is a good show. Try out "You Were Meant for Me":

Smooth.

Ok, Ok, enough soft side. A little noise to get the ear drums happy!

Ronnie James Dio is a metal god. Here is a live version of "Holy Diver" and I cannot believe the vocals:

In my opinion, Bruce Dickinson is the best metal singer ever, but Dio is a close second.

Not that he stops in here, but if Ilargi of The Automatic Earth stops in I will drive him crazy with Rage Against the Machine and a wild live show of "Vietnow":

Have fun, HA!

Two to go but I do not want to say goodbye!!!! I really do enjoy all the interaction and fun we all have together. Thanks for everything. Now, what to play, what to play......

A good friend of mine was telling me a favorite band of a friend of hers was "Def Lepud". Well who am I to say no? Try out "Bringing on the Heartbreak" by the real Def Leppard:

Classic!

Last call! Anyone want to mow a lawn for a song request? No? Geez.

As a goodbye song I offer Dokken and "Alone Again Without You" so the readers understand what it's like with no post for over a week, HA!:


Have a good night.

Thursday, April 22, 2010

Remain Calm, It's Easier That Way

Time is almost up! One day at work to go and then I will be off to the Bahamas for a week starting Sunday! When I go on vacation I am 100% offline; no papers, no TV, no Internet, and no phones. Not much to miss anyway, this song has been the same for 8 months now.

A Friday night send off will be in effect so get your requests in. Last weeks contest winner has selected a great tune and I am sure I will be pretty loose tomorrow night.

Turning Things Around
Economic Disconnect looked in the mirror last December and was not too happy with what I saw. Besides the amazing good facial looks (HA!) the old body was not what I would call "all it can be". I got on the scale and it read 165 pounds! I am 5 foot nine inches tall. Knowing that a vacation was at hand in the Spring I got the fine idea to try and make some progress. It has been quite a journey.

I bought a 3-way boxing set up (this one) that has a heavy bag, double end bag, and a speed bad for the old school boxing training that I used to do when I was a lot younger. I started in January.

After 5 weeks I felt tired, but very good. My hands were not bothering me much (I quit boxing due to chronic hand brakes/pain) so I was positive. I got on the scale and I was at 148 pounds! I guess I was carrying quite a bit of "extra" weight! Wow. At this point I could go 6 full 3 minute rounds on the heavy bag and a couple rounds each on the other bags with the weight training I do as well.

Tonight, after the last workout I will do before the beach, the scale reads 154 pounds, but none of what came back is the bad stuff. I can do 15 full rounds on whatever I want and I had to buy heavier weights for the strength training part. Not too bad. Of course this ate up time I could have been doing plenty of other things and my right middle knuckle looks about 2 times bigger than the left one, but I wanted to do this for myself very much. I am happy with the progress I made.

Remain Calm, It's Easier That Way
Nothing too in depth tonight, I am a bit tired and I am mentally on pre-vacation.

What I wanted to talk about tonight is the almost orgasmic response some have had over the "hard" data (pun intended) that seems to imply the return to absolute highs of, well, everything in short order. I could debate the problem with a bunch of this, but I really have thrown that towel in. Instead I wanted to take a step back and show you what I am seeing from my macro seat and welcome your input.

Right now the story is that consumer spending is at old highs, and going by retailer stocks going WAY higher still, home buying is on the rebound with a price breakout at hand, auto sales are ready to explode (sans nasty Toyota, what a scam), and anything else you want to throw in. Ok, I'll play.

At the same time, as in right now, we have:
-Unemployment at 9.whatever % (and if you buy that number, read USA today and not this blog)
-Wages have decreased for years
-The Home ATM is closed
-Savings are still non-existent
-bla, bla, bla you get it

To accept that the situation is old way normal means you accept that all the people without a job, less income, less access to free cash via home cash extortion, etc do not even count in the grand scheme of things. It is that simple.

With unemployment payments going on 2 years and looking for extension to even longer, food stamp usage at all time highs (there's your breadlines idiots), millions of homes either sitting empty or having squatters, I mean "defaulters" living for free, and US states looking like Greece on a good day financially, you have to ask what is going on.

To this I think of the film "Fight Club" and the scene where Project Mayhem replaces the safety cards in airplanes to show what really happens when a plane is going down:

Instead of the calm, serene view you get the panic that must come from such a thing.

I offer this:
IF
-If 10% of this working country can have no job, but be paid by the government to be calm
-If a record number of people need food assistance to stay calm
-If a never before seen number of people are losing their homes but remain calm due to various help programs or just free living to stay calm
-If the stock market, which is the EASIEST thing to goose, looks good many may remain calm
-If tax breaks which bite you in the butt can entice fools to buy cars and homes not only remain calm but get excited

THEN
-How many more can "remain calm" under the same process?

Right now this all works because, and let's stop playing nice, the world has to get down on their knees and "service" the United States due to this dollar reserve currency thing (too long to get into). Can the US be the engine for world growth if our central bank prints cash to pay all the "remain calm" types, buys our own debt and pretends its "temporary", runs deficits that makes no sense by any honest reckoning, and gets the biggest free ride of all time?

It will until it does not.

I have been so wrong on so many things. I admit that. It happens. I guess I figured people could think, but they just believe. Huge difference. Huge.

Now go buy Amazon (AMZN) on the dip and buy a GM car and then a house to park over the car. Might as well go all out, what could stop you? Above all, remain calm.

Have a good night.

Wednesday, April 21, 2010

All You Really Need to Know About Credit Based Expansion

The following lines from Bill Black's prepared testimony to the House Financial Services Committee really are all you need to know. Lifted from Tim Iacono's site:
Lehman’s principal source of (fictional) income and real losses was making (and selling) what the trade accurately called “liar’s loans” through its subsidiary, Aurora … The FBI began warning publicly about the epidemic of mortgage fraud in 2004 (CNN).
…
That loss, however, may not be recognized for many years – particularly if the liar’s loans become so large that they help hyper-inflate a financial bubble. In the near-term, making massive amounts of liar’s losses loans creates a mathematical guarantee of producing record (albeit fictional) accounting income. As long as the bubble inflates, the liar’s loans can be refinanced – creating additional fictional income and delaying (but increasing) the eventual loss. The industry saying for this during the S&L debacle was: “a rolling loan gathers no loss.”


"Young fool, only now, at the end, do you understand!" - Darth Sidious to Luke Skywalker

Extend and Pretend is option one, and it still is.

Jesse has the video embedded here.

Have a good night.

Tuesday, April 20, 2010

Limited Choices

Just a few quick hits this evening.

But I Thought High Frequency Trading was a Minuscule Part of Business?
A while back when some harped on the HFT games being played in the market (I used to post C stock graphs that moved liked oscillation waves) all the big banks ran out and claimed that HFT was a very small part of their business model and not really that important. Of course I believed them, HA!

I bring this up because once again someone has been bagged trying to steal this useless code that makes no difference:
The Next Sergey Aleynikov? Employee Arrested For Stealing HFT Trading Algorithms From Soc Gen
Samarth Agrawal was arrested today for stealing high frequency trading (HFT) algorithms from Soc Gen, according to Courthouse News.
In an amazing case that could be bigger than Goldman's alleged algo-thief Sergey Aleynikov, it looks as though Agrawal tried to steal complex algos from Soc Gen and give them to a competing financial institution.
HFT trading operations are very secretive about their algos. Everyone at a Mankoff Company HFT conference we were at recently jumped when someone mentioned the purpose of one particular algo he had learned of. None of the traders we later asked would give us any other examples of the algos they use.
"It's proprietary information," we heard repeatedly.
If this is such a small fry, why all the fuss? I think you can figure it out for yourself.

Greece to Get a Really Long Term Extension
Extend and Hope may well be the new way to tackle structural issues. With Greece about ready to enter the IMF bailout deal, Sudden Debt has a nice write up on what will probably happen:
Most Likely Scenario for Greek Debt Crisis
I expect, therefore, a voluntary debt swap i.e. swapping bonds coming due over then next 5-10 years for longer maturities, maybe with a self-amortization feature, along with the IMF/EU funding package. The voluntary feature will likely be there to avoid triggering a credit event under CDS terms, but if structured properly most everyone would want or have to participate - a.k.a. a shotgun marriage.

For example..
Concurrently, the Greek government could enact more revenue-enhancement measures (that's what new taxes are called, in beffuddle-the-masses speak), probably a real estate ownership tax. Such a tax could easily raise 5 billion euro/year (current debt service runs at 12-13 billion/yr) and, crucially in a country where tax avoidance is the national sport, would be nearly impossible to avoid.

Take that tax money, segregate it into a special account administered by a Paris Club-type of group, earmark it for the sole benefit of those accepting the debt swap with first-lien bonds and voila..

The key element in such a deal will be to structure it in such a way as to minimize immediate stress in the balance sheets of major Greek debt holders, i.e. foreign and domestic banks, plus pension funds. Given the generously stretchy accounting rules for banks holding sovereign debt, it shouldn't be too difficult.
Hard to argue with any of that. Does this not make the Greek debt Crisis more of a long term refinance deal? How long until many countries roll their debts out 20, 30, 1000 years? Who knows, and who cares. Expect a monster rally on this deal should it go this way.

Apple (AAPL) is Huge
Is Apple really a 225 Billion dollar company? How much useless crap can people buy anyway? Don't bother telling how awesome this stuff is, I don't need any of it (gadgets of all sorts not just Apple ones) and really no one else does either. Each to his or her own, but that is an amazing market cap.

Limited Choices
Here is what it feels like to be faced with "Financial Reform" in American politics:
-Democrat Bill (mainly by C. Dodd) is crap and will not do anything at all. Argues that regulators will regulate if given more regulatory powers like all the ones they did not use the last time
-Republican Bill (a few players) argues no more regulation but end too big to fail, which we all know is crap. Remember George W Bush: "I had to chuck my free market belief in order to save it". This means bailouts forever as well.

What do you do? I guess as of writing there is some kind of bipartisan package which may come online, but it will be terrible as well.

This is the best our so called "best and brightest" can do for us? Two inadequate Bills? A nice photo op, hand shakes all around, and press releases saying all will be well. You know when we have real financial reform? The S&P500 will drop 30% in 2 days, that's when. When the financial sector rallies after one of these bills gets passed you KNOW they are crap legislation.

You get what you deserve, and I am sure we will.

Have a good night.

Monday, April 19, 2010

Nothing to See Here, Move Along

Another very long Monday........

Tonight's post will be short as I am out of energy this evening. Vacation cannot come soon enough.

Off Topic But Interesting
I caught this link over at Naked Capitalism today:
Mat of microbes the size of Greece discovered on seafloor
Gargantuan whales and hefty cephalopods are typically thought of as the classic marine mammoths, but they might have to make way for the mighty microbes, which constitute 50 to 90 percent of the oceans' total biomass, according to newly released data.

These tiny creatures can join together to create some of the largest masses of life on the planet, and researchers working on the decade-long Census of Marine Life project found one such seafloor mat off the Pacific coast of South America that is roughly the size of Greece.

A single liter of seawater, once thought to contain about 100,000 microbes, can actually hold more than one billion microorganisms, the census scientists reported. But these small creatures don't just live in the water column or on the seafloor. Large communities of microscopic animals have even been discovered more than one thousand meters beneath the seafloor. Some of these deep burrowers, such as loriciferans, are only a quarter of a millimeter long.

I have written plenty of times on the biodiversity available in the worlds oceans. Getting these bugs to grow in a lab is the holy grail of new drug discovery. Natural products have long been a high source of new drugs, and untapped ocean creatures could hold promises of new molecules. Some more story:
Thanks to high-throughput DNA sequencing, researchers have been able to vastly expand their catalogue of marine microbes. "Scientists are discovering and describing an astonishing new world of marine microbial diversity and abundance," Mitch Sogin, of the Marine Biological Laboratory in Woods Hole and leader of the International Census of Marine Microbes, said in a prepared statement.

This genetic data has revealed that there might be as many as 100 times more microbe genera than researchers had assumed. One study conducted in the English Channel landed 7,000 new genera alone. Current estimates place the number of marine microbial species at about a billion, according to a prepared statement by John Baross of the University of Washington and chair of the International Census of Marine Microbes's scientific advisory council.

And research has yet to plumb the guts and surfaces of more macro ocean life, which, like humans, can play host to billions of microbial cells. The species living on and in "marine animals alone may account for hundreds of millions of microbial species," Baross said. "This is a huge frontier for the next decade."

I actually have experience doing this kind of thing. I shotgun cloned soil DNA from California tidal pools and sequenced the Ribosomal binding units (ubiquitous in bugs) and found the diversity level to be enormous. I am always looking at this area for progress and possible future investment. It is very interesting in any case.

Is the Goldman Sachs Story Over Already?
Just when it seemed Friday that the Goldman fraud charges were going to open a new chapter in how banking is done in the country, I think the markets are moving along. Just when the pressure on GS was reaching a high over the weekend on all the news shows, Monday brings this deflator:
Market Powers Higher As Investors Realize SEC's Case vs. Goldman Sachs Is Weak
Adding to that was the news the Republicans were voting against the charges on GS:
SEC Republicans Were 100% Against Going After Goldman

So far I have not chimed in on my thoughts on the whole thing. Here is my quick take:
-Goldman did not break the law nor conduct "fraud" in the strict legal sense of the law.
-This matters about zero to me if the charges bring to the surface all kinds of shady dealings that the big banks conduct. I would settle for trumped up charges that lead to a real pulling back the curtain on the banking industry.
-Did you forget that GS is a "bank-holding" company now? That privilege needs to be rescinded immediately.

All told, this story was chilled out a bit today. No doubt the one down day in the last year on Friday may have cooled the jets of players everywhere. I do find the humor in that once it is clear GS will not really be taken to task, the markets get happy! Why change what's working? Indeed.

For another reminder how banks are using fraud, I mean, accepted accounting rules to make monster profits, check out this article from The Golden Truth:
Citigroups Mark to Fantasy Profits: Is Vik Pandit Dealing Medical Marijuana?
Short version: Mark to Myth is the best game in town.

Levels Above My Pay Grade
There are two stories I wanted to point out today because I think they really flesh out just how big a gamble, and it is a gamble, the FED has taken by supporting trash assets with the taxpayer balance sheet at risk. These two tales are very important, so no excerpts, you should read them!

First up from The Baseline Scenario:
The Discount Rate Mismatch
A sweeping look at a key issue going forward.

Along the same lines comes this item from Alan Boyce (via Chris Whalen and Zero Hedge):
A Return To Rate Normalcy Will Cost The Fed Hundreds Of Billions; The Fed Will Go "Negative Carry" In 2015: D-Day For America
A great summary of the side effects of the FED buying all the mortgages for the last year. Make no mistake, this is a gamble in process and it is not clear it will work out in the end.

Have a good night.

Sunday, April 18, 2010

Sunday Solution

Please bear with me this evening. Last night was boys night out; we went out for a LONG time and today I was OUT of commission for most of the day. To be young again! Lets go over the puzzle from Friday.

DNA Puzzle
I was surprised to find two correct solutions in the gmail today! Hats off to Au Soleil Levant and reader TS who both had the correct answer. I have communicated the possible winning prizes and await selection information.

Ok, so now the puzzle.

The submission was:

5'-GGCCGTGTATAGTCGCGGGTTATGTTG
GCCTTGTAAGACCATGCACGAAAACCG
CTACGCAAATACAAGGATAATGAGCGC
TCTCATTGCGAGTTGATCTGGCAGTGC
AGTTTCCGGAATTGGTGCGTGGCCAAT
TTTTTTTTTTTTTTTTT-3'

I mentioned the strong kozak leader would be in play.

5'-GGCCGTGTATAGTCGCGGGTTATGTTG
GCCTTGTAAGACCATGCACGAAAACCG
CTACGCAAATACAAGGATAATGAGCGC
TCTCATTGCGAGTTGATCTGGCAGTGC
AGTTTCCGGAATTGGTGCGTGGCCAAT
TTTTTTTTTTTTTTTTT-3'

Which gives us the target sequence:
5'-ACCATGCACGAAAACCG
CTACGCAAATACAAGGATAATGAGCGC
TCTCATTGCGAGTTGA-3'

The coding sequence shown in the triplets to be read:
CAC-GAA-AAC-CGC-TAC
GCA-AAT-ACA-AGG-ATA-ATG-AGC
GCT-CTC-ATT-GCG-AGT-TGA

Using your handy dandy codon chart reveals:
H-E-N-R-Y
A-N-T-R-I-M-S
A-L-I-A-S


So the hidden question was "Henry Antrims Alias"?

The answer is Henry McCarty, William H. Bonney, maybe Brushy Bill Roberts and of course......
Billy The Kid!

I hope anyone that tried it out had a good time.

Of course, the film Young Guns and Young Guns II featured Emilio Estevez as the outlaw:

The opening scene of Young Guns II features an older Billy the Kid making his plea for a pardon. Interesting indeed.

Welcome to the Light
My good friend that I was out with last night shocked me in that he had never heard the song "Children of the Grave" featuring Randy Rhoads on the Tribute Album. When we got back in I loaded up the tune and he was blown away! The entire album features the true genius of Rhoads and this song showcases his ability to give motion and meaning to a song in a live performance. This tune and "Crazy Train" from the Tribute album are the finest guitar works I have ever heard and I love it!:

Go to the 3:00 minute mark and enjoy!

Have a good night.

Friday, April 16, 2010

Friday Night Block Party

T- minus 8 days until the Bahamas welcomes me back for my 7th visit and 6 year wedding anniversary. How anyone can stand me for 6 years I have no idea, but I try not to ask as to not encourage the wife to think too much about it!

Friday Economic Recap
There were a couple of things I wanted to highlight, but I will be brief as I am getting more and more jaded on things as of late.

Goldman Sachs Charged by SEC
By now you must have read about Goldman being charged by the SEC for their sale of a set of CDO's that GS may have not fully been up front about. The charge is fraud. I have looked over the details and I think that in the strict letter of the law sense, Goldman would win a legal battle. The spirit of the law was bent about as far as it could go and this could cause problems for GS as well. Selling garbage and then betting on it's collapse (I am not talking about Greek debt sales by GS!) is pretty dirty, but probably legal in some way that is beyond me.

My favorite headline of the day, via EconomPic:
Goldman's Stock Crushed.....All the Way to Last Month's Level
Awesome! Shows how far stocks have been running as of late.

Goldman has come out swinging but really they should pay the 50 million dollar fine or whatever it will be and move on. If this gets into court they will have to detail more and more of their transactions and that could cause a real issue for their public relations.

I have seen a few places that Goldman may have, I repeat, MAY HAVE shorted their own stock and/or futures based on a heads up by the SEC. Now if that turns out to be the case, GS has no wiggle room and has broken the law in every sense. We can all hope this was the case!

Everyone is Stupid But One Guy
You know I have no idea why people seem to annoy me all at once, but Barry Ritholtz does it again!

Today Barry pens:
Are Defaults Really Driving Retail Spending?
I was interested in the piece because I have spilled some ink on this as of late. As I have written, I was skeptical at first but have warmed up to the idea based on some number crunching submitted by reader Moneta and some articles by Diana Olick and Edward Harrison. I looked forward to another take.

Well Barry goes nuts on a Housing Wire article that focused on one example of a HAMP applicant that went crazy with spending. Fair enough, one example does not make a fact. Then Barry goes off the deep end:
A few of the usual brain dead media suspects picked up his post as proof of some talking point or another. Merely repeating other people’s weak ass comments isn’t news — its somewhere between

Disappointingly, Diana Olick of CNBC also got drawn into the silliness. her work is more often than not excellent. Not this time, omitting both in depth research into retail sales and analysis of the actual data.

She should know better
Well now you know.

Barry Ritholtz has offered up his perfect analysis of retail sales and finds that defaulters have zero effect. What are his data sources? We don't know. How does he figure out how much money may be freed up? No explanation. Barry just calls anyone thinking this is possible brain dead. The Edward Harrison piece I linked yesterday had numerous examples, not one, but Barry never got around to finding that one. Barry states his interpretation of data as fact. Barry has been keen on pointing out everyone else's bias for a few weeks, so let me help him out:

If you think your interpretation of data is perfect and everyone else is wrong you have a blind spot.

Seriously, this was way out there. Maybe time to update the Must Read blogroll, again. Any ideas on a replacement? Leave ideas in the comments.

Friday Night Entertainment
Indeed it is time for a little unwind!

DNA Puzzle Return
A while back I started a few DNA based puzzles for the readers to solve and I think it was fun, though folks found it hard. I have been doing this stuff for so long I can almost see the amino acid letters in DNA sequence. I told you I needed a vacation!

Anyways, here is the first post I did and it has the keys you will need to translate tonight's puzzle and another post which explains the Kozak sequence. This puzzle will have a strong kozak, a start signal (the M letter will not factor into the puzzle, ignore it) and a stop codon where the message ends. I have hidden the message among decoys so good luck!

5'-GGCCGTGTATAGTCGCGGGTTATGTTG
GCCTTGTAAGACCATGCACGAAAACCG
CTACGCAAATACAAGGATAATGAGCGC
TCTCATTGCGAGTTGATCTGGCAGTGC
AGTTTCCGGAATTGGTGCGTGGCCAAT
TTTTTTTTTTTTTTTTT-3'

The solution is a question that you must answer as well! Email me your response (as not to blow it for everyone else) to the gmail at the left and perhaps a prize will be involved. No cheating! Solution will be posted on Sunday if no takers are found.

Picture Time
Visual comic relief.

The true talent of the Beatles Cat style:
funny pictures of cats with captions
see more Lolcats and funny pictures

Spell Check needed:


Wii Can be Dangerous
Now I know plenty of people love the Nintendo Wii and I feel it is my obligation to report any risk issues with the product. I submit, without comment, the following advisory:
Wii Fit injury turns woman into a sex addict!
Careful out there!

Film Clips
Have not had a film clip in a bit.

Josey Wales meets Lone Watie in "The Outlaw Josey Wales":

Love that scene.

Rock Blogging
As always, it is 3am Eternal here and it is music time, thanks KLF for the intro!

Lurker suggested Al Stewart and "Year of the Cat" which I had never heard:

Not bad at all! Lurker knows some tunes.

Sorry to Gawains, but Jethro Tull is a no go. I never could forgive the Grammy Award travesty when Tull beat out Metallica for the "Hard Rock" award many years ago!

Watchtower wonders if I would play "Layla" by the genius Eric Clapton. Wonder no more:

Sweet version too!

My commute home was long on a Friday due to rain, but a super sweet double header on 93.7 Mike FM made the journey easy. Back to back classics! First off was Dire Straits and "Sultans of Swing". Next up was The Eagles with "Hotel California", and I flipped a coin so you get the Eagles (acoustic version):


Brett Michaels, the lead singer of the mega band Poison, had an emergency appendectomy this week. I wish him all my best and I KNOW you do too! HA! In honor of his recovery I offer Poison and "I Won't Forget You":

Love it!

A little Guns and Roses goes a long way. Take a walk through "The Garden" with Alice Cooper on back up vocals:


Last call! What to close the curtain with???? You all think this is easy, but it is not!

Now understand that I have NO IDEA why this song was stuck in my head most of today, but I do what the voices in my head tell me too (most of the time!). Closing the night with the get up and get crazy fun tune "Let The Music Play" by Shannon:

You gotta get groovy on that one!

Have a good night.

Thursday, April 15, 2010

The View From Up Here

The electric contractor finished the new generator installation today. I am very impressed with the product and think it was a great addition. Of course now that I have it we will never lose power again! Goes to show ya!

Two Things Not to Worry About
Just to show you all I am not all gloom and doom, here are two things I see coming up often that are not worth much worry at all.

Israel (or whomever) to Attack Iran Over Nuclear Program
This will not happen. There may well be plenty of noise but nothing will come of it. Iran will have a workable nuclear device within the next year (if they do not already) and they will have to live with that fact. The US will posture as angry and Israel will be pissed to a degree not seen in some time. Nothing will come of it. Iran is too dangerous to mess with and any bomb they could possible build, if fired, has as good a chance of hitting Jordan, Syria, or South Africa due to their missile technology ability. No one will like it, but nothing will happen. Iran will figure out all that money they blew on the program raises their place in the world community not one nanometer. Just my 2 cents.

The Iceland Volcano is a Mess, but not a Calamity
Unless you need to fly this week the amazing volcanic eruption going on in Iceland should not cause long term damage. See the Wikipdia write up here. Seems only fitting that the UK wants their ponzi money back through the icesave program and Iceland sends them a plume of volcanic ash as payment. You cannot make this stuff up!

If interested, you may find the Year Without a Summer a great history lesson on what happens when a monster volcano (Mount Tambora) really goes up and causes a seasonal change. Pretty wild.

If it Matters
If anyone really cares about the story regarding debt defaulters going nuts with their new found money, Edward Harrison has a great write up on it:
Strategic Defaults Increase Consumer Spending
Some pooled examples from various sources (including Bill Fleckenstein):
My anecdotes on strategic defaults
Here’s what I have uncovered via two anecdotes a friend sent me.

This first one comes via Bill Fleckenstein from a retired hedge fund manager. Catch Fleck via his daily newsletter (subscription) or his MSN column, which is free. Bill says the reader told him the following five anecdotes:

1.My 25 year old niece had $10,000 of outstanding credit card debt. Recently, she told the bank she couldn’t pay. She is not unemployed so the ‘hardship’ is all relative. Nevertheless, the bank offered her a concession which she refused. They offered another concession, she refused again. Finally, they told her if she paid $150/month for 2 years (total of only $3600 with no interest), they would call it paid in full! She accepted in a heartbeat. It is less than a month later, and she celebrated her good fortune by going on a cruise to Hawaii.
2.A friend owns a small manufacturing co. He tells me of one of his female employees who was saddled with a $450,000 home she purchased almost five years ago with no down pmt. One year after her purchase she pulled $75,000 home equity and purchased ‘fun stuff’ including a boat. She recently walked away from the house (now saddled with $525K mortgage), purchased a new house for $200,000 (in her sister’s name) and kept all the goodies purchased from the home equity withdrawal. With the much lower mortgage payment she just bought a new car.
3.Almost everyone in my "survey" is aware of, or knows someone living rent free in their home for an extended period of time, having stopped paying their mortgage. Many of these free boarders are spending lavishly on non-essentials. My hard-working part-time assistant knows two different 35+ yr olds who have enjoyed over 9 months (one is up to month eleven) of rent-free living in very nice homes they purchased in 2004/2005! Both are employed and both enjoy a non-frugal lifestyle. My assistant wonders if he should do the same or have me pay him more so that he too can enjoy the ‘good life’.
4.My sister is a nurse with 25+ years on the job. She told me of a young couple that she is good friends with that both work at her hospital making a decent joint income. They didn’t like the fact that they grossly overpaid for their 3000 sq ft home in 2006. They stopped making hefty monthly payments six months ago and haven’t yet been contacted by the bank. They have decided to wait until contacted and then walk away. In the meantime, they just returned from NYC from a week vacation in the Big Apple.
5.My brother-in-law wanted to know if he should stop making payments on everything. He lives in Virginia and his carpentry skills are not as marketable as they were in the height of the boom. He and his wife’s best friend have lived close-by for many years. For the past 13 months since they strategically decided to stop paying their mortgage, they had yet to be contacted by their bank. Not even one letter! My brother-in-law doesn’t understand how they get to pocket the mortgage and spend carefree, including a 10-day Caribbean vacation.
I can list numerous other, verified examples. And these are just from my tiny, tiny universe. I can’t help but assume if I know of this many instances, there must be millions of similar stories across the country. And I am sure many of your readers have first or second hand knowledge of similar situations.

Bill, for me, the weight of evidence is pretty powerful. I am convinced that it is a specific government policy to increase consumer spending by allowing massive debt repudiation. And, I think they are pulling it off, at least for now.

Another hedgie in San Francisco, responded with this after seeing these anecdotes:

From the West Coast I have at least that many stories. They come in clusters. One brave party takes the first step and "wins" then relatives or co-workers follow the successful example. The persons are still employed – default on debt – they rarely get contacted by lenders and then negotiate hard (the debtors that is). After some settlement they keep spending lavishly. In every case a vacation is part of the program. Every case!

In one example 5 employees at a local business that caters to wealthy clients have defaulted. The first guy and his ex were a classic accident waiting to happen – big lifestyle and all on borrowed $$. He’s still in his place 19 months later. Then a guy who got his hours cut back – same story. The last two are STILL making over $100k. No one is making his mortgage payment. No one is in foreclosure yet – only the first guy has even been contacted and he’s the most underwater. The last two (one guy I know well) are still religious about the credit card debt, however.

I have a place of the beach in Mexico. One of the newer buyers on our beach got the money from a refi in Oregon in 2006 (about $300k). He stopped paying last year on his Oregon place – still has the house, no proceedings – just some letters. He even rents it out during the winter to another couple who walked away and mailed in the keys on their home last year (foolish them!!).

Small business here are getting killed, however. There is very little new money and the terms to renew a line, or refi a CRE mortgage, are crazy. Almost all small business lines are also tied to assets – real estate in most cases – and it’s very hard to renew with a smaller bank.

I know this sounds like lunacy but these are stories I know personally.

Clearly this is not scientific data in the least. But I hope you see the evidence is pretty substantial that strategic defaults are indeed goosing retail sales. The question is what comes next?

How this matters now that the economy is fixed and everything is going parabolic I have no idea, but I still find it amazing this crap happens and nobody has to answer for any of it. What a country. My Dad always said "You Get What You Deserve" and after 34 years I have found that to be a universal truth.

The View From Up Here
After being bombarded with bullish commentary for about 6 months now (yes, it has been that long!), say I am convinced all is not only well, but so awesome that this is a once in a lifetime opportunity to jump on a bright red flyer bandwagon and get rich in a timely fashion. I will note a few structural points as to why I may be unconvinced, but then we will look at a few numbers and discuss the "new economy" that we have built.

I could bla bla you with details and provide backing information, but why bother? Here are my reasons nothing has changed:
-Housing still is terrible
-New home construction and selling does more for the economy than existing ones; when the wave of foreclosures hits later this year new home sales are done
-Bad debts held by the banks (well, what is not parked at the FED anyway) still renders most banks close to insolvent
-Unemployment at +/- close to 9% for years to come (many reasons why, why bother telling it again?)
-Wage pressures to the downside
-Serious State debt issues
Well, I will stop there as I was getting a little bearish for a second and that does not reflect the reality on the ground.

The view from here using the S&P 500 as my proxy:
Today's close was 1210 (1211 something but I want the numbers round!)

The last all time high for the S&P was 1561, set on 10/08/2007.

After a small pull back around 5/12/2008, the S&P sat at 1425.

My math using 1210 as the start shows (from today on)
-A 10% move arrives at 1331
-A 20% move comes out at 1452
-A 30% move ends up at 1573

I will say that a 30% move this year will not happen. The 20% move is highly likely, and the 10% move I can all but guarantee (NOT trading advice).

Why? Everything right now numbers wise is still terrible, but not end of the earth bad. Wait until the census jobs hit, orders go up even more, and the numbers look just far from normal! You think you have seen a rally so far?

I bring this up because at some point this year (by October?) the S&P will be sitting at around 1450 and things will seem strange. Foreclosures will be accelerating, unemployment will still be very high (forgot all those who quit looking did you? Wait until they think they can get a job!) and home sales will still be poor outside of the auction block properties which are not really part of the "real" housing market anyway.

One may think with all that positive activity the FED may want to raise rates, but that's a pipe dream. Low rates are here forever, try to take that in, everyone else has and has bet accordingly.

So what is the face of the "New Economy"? Here are the key points contrasted with the old one:
OLD
At the old highs the engine of growth was a credit boom fueled by overextended money in all channels via loans by banks
NEW
Growth comes from super-extra-extended-double secret unemployment benefits payed until a ten year span has passed. Add to this all the "free" money from previous debt defaults (still not written down by the banks, but why worry they will grow their way out!)

OLD
Rising home prices allowed at the time owners to extract "equity" and spend like mad.
NEW
Housing was never a big part of the economy! See, everything is fine now!

OLD
Good paying jobs actually doing stuff were lost overseas and replaced by low paying jobs in the "service" industry. Hey, a job is a job!
NEW
Well some things never change but think of all the spending money to "service" coming online!

OLD
The Financial sector accounts for all the big money in the economy due to their amazing ability to be smarter than any one else.
NEW
The Financial sector is larger than ever (especially the big banks) and now they are armed with a 100% taxpayer funded backstop should anything go wrong! HUGE improvement.

OLD
Americans for the most part fail to understand that saving and staying out of debt are the keys to financial freedom.
NEW
With all the freebies and years payment free, there is now no way these jokers will ever figure that out! WHEEEWWW, dodged one there!

OLD
If the country is brought to a point where "tanks in the street" are a possibility, and not due to a "Red Dawn" type scenario, those who represent us will make sure it never happens again.
NEW
Wow, 3 guys retired and Massachusetts elected a Republican that votes democrat! That's all we have to fear? What a deal.

All in all, the "New" economy seems pretty good. All you have to do is believe and read the papers. Seems just like 2007 all over again. Nothing at the core has changed since then, just mood and perception.

Maybe I will revamp this blog as a Sci-Fi, Molecular Biology, NFL Football, BBQ smoking, 80's pop culture, and fishing site. Nothing really to see or point out until the next wake up call sounds. What do you think?

Added:
Of course Friday Night is upon us and I feel a ripper of a funfest on the way! Get your requests in!

Have a good night.

Wednesday, April 14, 2010

A Few Thoughts

Out of any real time so just a couple of thoughts.

What is the Story on Volume?
When you start getting to a place where things are out of hand, say after a non stop train ride to old stock highs, people get a little dizzy and start making things up to match something they see. Take volume during the stock market run up. It has been low. It has been really low. Days of UP moves (every day) are very light and days of DOWN moves are light, but heavier than the UP days. I can read a volume chart thanks. Of course you can see some other takes.

Barry Ritholtz notes that John Roque offers:
“Volume has been a curiosity for most and a problem for others. On an absolute basis, 2010 volume is averaging about 4.7 billion shares/day. This is down 15% vs. the 2009 average NYSE volume of 5.5 billion shares/day. Yet 2010’s average volume is only slightly less than the 2008 average of 4.96 billion shares/ day.”
Sounds reasonable.

The chart provided has some useful information:


A comment left hit the bases I wanted to cover:
flipspiceland Says:
April 14th, 2010 at 1:11 pm
How much of the volume is being generated by just a few entitties? vs 2008
How much of the volume is concentrated in Citibank? vs 2008
Good questions indeed. The same stocks are heavily traded, and I mean heavily traded. Banner names like AIG, FNM, FRE, C, BAC to name a few.

Another comment summed up the HFT angle:
crunched Says:
April 14th, 2010 at 3:01 pm
None of these points mean anything because the proliferation of HFT and Program trading has expanded beyond measure SINCE 2008. If you factor out all the computers trading against each other for the sole purpose of rebates, every hedge fund inching the market higher based on their latest algo, the Trading desk at the Federal Reserve spending all our tax dollars pumping up name-brand ETFs so Joe Sixpack will buy stocks again… there isn’t much volume left. Hardly any, in fact.
Of course there is no real way to get an accurate HFT trading number, but certainly this is a factor as well.

One more from me. For all the "Rate of Change" maniacs that get all sweaty because some bad number is getting less bad more slowly, please note the RATE OF CHANGE FOR VOLUME IS GOING THE WRONG WAY! Sorry to yell, but it amazed me how intellectually bankrupt most people are. Also, the first year over year outright contraction in 18 years. But volume is the same. What ever.

Of course the mess that occurred in the bust was a factor in volumes for dog stocks. But even now some of the small change stocks command sometimes 25% of a days trading volume. Seems weird to me but I am an amateur. Two 5 year charts to think about the volume angle:
Citigroup (C):

Nothing strange there in regards to volume.

AIG:

Again, very normal. You have to squint to see the huge volume before the last two years, but it is there.

Look, maybe the new bull market will be in backstopped firms and those volumes mean more, but to pretend the market is internally backed up by the volume numbers is a stretch.

Where is the Money Coming from?
As we all know we are now in the midst of a new consumption spree and people who just a short time ago could not pay their mortgage now have money to blow on goods of all kinds, and not just higher priced gasoline. With a lack of job creation, wages stuck at neutral or in reverse, and no ay to make any money unless you want to play the stock market, just where is this money coming from anyway? Surely if everyone has enough cash to blow on an Ipad, they could maybe pay their mortgage instead and get me off the hook for it? Just a suggestion.

I have been skeptical that defaulting borrowers (all kinds) were behind this new drive of buying, but I am warming up to the idea. Last week in the comments reader Moneta did come envelope math and found:
You will find delinquency rates.
http://www.federalreserve.gov/releases/chargeoff/

Delinquency Rate (Residential RE):
4Q2009 = 10.80%
2Q2008 = 4.15%
2Q2005 = 0.07%

Let's say there are 110 million households in the US and 40% are mortgage free. That means 66M have a mortgage.

If 11% are not paying, it's probably those who have a huge mortgage because the others would want to keep their house.

So 1500$ * 12 = 18K per year + 3K in taxes = 21K in new found money per hh.

7.25 million * 21K = 150 billion ore for consumer goods.

Plus don't forget the thousands per household that were being spent on real estate and going into private fixed investment. Now a lot of this money is probably going into consumption... who would anyone want to put more money than they need to in a depreciating asset?

Let's say 25 million households are putting 5K less towards fixed investments, that would give them 125B more to spend on consumer goods.
Not a bad estimate in round terms and I noted at the time that numbers like that made it possible. I was still not 100% sold though.

Today another estimate comes out, and it is not very far from Moneta's guess (via Zero Hedge):
The Benefits Of Contract Abrogation According To Mark Zandi: 6 Million People Not Making Mortgage Payments Frees Up $8 Billion Each Month
Diana Olick get's Mark Zandi's take (yes, that Zandi! Do a search he pops up plenty here!) and his guess is that maybe 8 Billion a month is set free after mortgage default:
Diana Writes:
Then I decided to ask Mark Zandi, of Moody's Economy.com, who will often shoot down my more ridiculous theories.

I asked him if this was a crazy idea:

"No, not crazy. With some 6 million homeowners not making mortgage payments (some loans are in trial mod programs and paying something but still in delinquency or default status), this is probably freeing up roughly $8 billion in cash each month. Assuming this cash is spent (not too bad an assumption), it amounts to nearly one percent of consumer spending. The saving rate is also much lower as a result. The impact on spending growth is less significant as that is a function of the change in the number of homeowners not making payments.

I'm not sure I would say this is juicing up spending, but resulting in more spending than would be the case otherwise.

Many of these stressed homeowners (due to unemployment) are reducing their spending, just not as much as they would have if they were still making their mortgage payment."
Not too far from the reader math!

Of course Mr. Zandi is always an optimist. In regards to defaulters blowing their new found cash as we all have to pay for their home (one way or another) he offers this gem:
"In some sense there might be a silver lining in that."

Well we have that going for us, which is good.

All of this makes me want to throw up. Will Ben Bernanke ever have to answer a question on this issue? Moral Hazard is a nasty thing and I never even thought of this angle. The new bull market may be in "strategic defaulters". Which stocks to buy then, retailers? Oh wait, have you seen the run retailers are on? Forget I said anything.

Have a good night.

Monday, April 12, 2010

A Tale of Two Debt Markets

Some Monday's seem longer than others. Today seemed very long indeed. Almost vacation time and I need it very badly.

Homework Assignment
I have to admit that I have no idea what any of the following means, so if anyone has some thoughts I would appreciate it if you left a comment.

Market Ticker had a couple of posts up today which showed a monster change in the "Total Loans and Leases of Commercial Banks" which is dubbed TOTLL. Here is the first one:
Did the FED Just Bail Out Europe?
and then a follow up:
What the Hell? (Outstanding Credit)
It seems yet another change has been made concerning bank balance sheets and how some items are accounted for. The relevant notes from the FED can be seen here:
April 9, 2010 Notes
I really cannot make heads or tails of this thing. What I can gather is that banks are moving some things back onto their balance sheets but it is not clear why this is happening or what it accomplishes. Have at it.

A Tale of Two Debt Markets
The latest greatest saga is the credit issues facing the nation of Greece. Stop me if you have heard it before; country with structural budget issues in a recession and having no real desire or ability to cut spending needs access to cash or they will default. Same old story all over the world.

I am often reminded that the "bond market" is the most powerful force in the financial universe. I would offer that the bond market's influence is losing ground in the face of never ending manipulations by the central banks of the world.

Which debt market is the real one? Here are two to choose from:
1-Greece is facing rising interest rates on their debt due to various issues and that rate has hit about 7% for even short term debt, far above what "normal" nations can borrow at.
2-Greece is being handed loans at 5% from the IMF/Eurozone to sidestep those pesky debt markets.

So which is it? From all the stories I have read it is #1 but through some creative use of bailout threats the plan is to make #2 replace #1 using the "free" markets.

Here are some clips:
Bailout details ease Greek borrowing costs
Note this section:
"Short-term, Greece needs lower interest rates. If the rates do not go down, I think they will use the mechanism," Agapitos said. "I think it's been a case of a domino. Greece promised, now Europe has promised, now Greece has to take the gun and use it if the spreads do not go down."

Germany, which has vehemently opposed a bailout for Greece, said Monday that the time had not yet come for the aid to be used.

"Just putting up a fire extinguisher on the wall does not say anything about the probability that it will ever be needed," German government spokesman Christoph Steegmans said.
Another Hank Paulson "bazooka" convert.

The Baseline Scenario offers this missive:
Greece Saved For Now – Is Portugal Next?
Summary sentences:
Surely the eurozone will bail Portugal out also – but where would it stop after that? The stronger Europeans, by coming to Greece’s rescue at this time with little conditionality, are effectively showing all the weaker nations that they too can get a package. This will undoubtedly reduce the resolve for needed fiscal reforms across the European periphery.

We are still lurching from crisis to crisis in Europe.
What a mess.

Try and remember that sovereign issues are not peculiar to the Euro zone. US States are having the same kinds of problems.

What does this all mean?

Just as with mortgages, the free market said "no more at these prices" and so the government issued and bought them all. Greece has funding issues and cannot pay a punitive rate, so they will not. Well, at least not until the unneeded bailout plan is rolled out. Tuesday is a debt offering day for Greece so we may get an answer at that point.

The overall economic system cannot function without ultra low rates and to this end we are seeing the greatest expansion of sovereign balance sheets to make it happen. How long can borrowing rates stay at all time lows? 5 years? 10 years?

What is most disturbing is there is still no grand plan anywhere; everyone just moves from one crisis to the next never trying to see the big picture. At some point all of these promises will have to be paid up. I have written plenty on the "Total Miss Pricing of Risk" and here is another example. I wonder how long this can all go on.

Have a good night.

Sunday, April 11, 2010

Metals and Victuals

Plenty of yard work this weekend. The street sanders really did a job this winter because there was about 100 pounds of sand at the start of my lawn on the street. That took some serious effort to remove. Today was mulch day. Things look pretty good.

I had a few minutes to spare so just a quick word and some pictures.

Metal Mania
The author of the blog "The Golden Truth" was featured in a guest post spot over at Zero Hedge. The writer is a friend of EconomicDisconnect and his site appears in the blogroll. If you have questions regarding the fund GLD I am sure this will answer them:
Guest Post: Got Gold? Why Owning GLD Can Be Hazardous To Your Wealth
Congratulations for the Zero Hedge spot!

My own position is that the ETF funds GLD and SLV are fine for trades. They are not physical metals and should not be considered as such. The article can flesh this out in detail.

Sticking with the metals, JP Morgan's silver antics made a big paper, the NY Post:
Metals are in the Pits; Trader Blows Whistle on Gold and Silver Price Manipulation

It is clear how I feel. With Greece getting another extension of cheap money you can be sure the other problem states are looking for the same deal. Here in the US the states are now coming to a head with funding issues and will be bailed out by printing money. Add to this the severe shortfall in pension funds, mortgage delinquencies that keep rising, and higher borrowing costs that will cause QE 2.0 soon I think you can see the paper money spigot is about to go crazy. Gold and silver can be an insurance policy against an avalanche of new paper coming online. This is not investment advice, just how I feel.

Victuals on The Big Steel Keg
You know that is pronounced "vittles", yes?

I decided to go for a double header today. For lunch I made pizza on the Keg and it was really good:
Photobucket
Nice!

I had to cool the Keg off from 500 degrees back down to about 300. I did a "beer can chicken" where you sit a small whole chicken on a beer can to get really juicy meat. Here is the bird on the throne:
Photobucket
After about 3 hours it was done:
Photobucket
I think I left in on just a bit too long, but it came out very good regardless.

No worries this will not become a food blog!

Have a good night.

Friday, April 9, 2010

It's Friday Night Live!

The rain has returned once again. Last weekend was a big tease I think; cold, wet and raw is more the Spring I know! 2 weeks to go until I am on a beach in the Bahamas so I can make it! I hope to see some (warning, cheesecake ahead!) picturesque beauty on the beach.

There are at least 5 things I wanted to discuss tonight, but one item in particular has bothered me all day so I will go with that and leave the heavy stuff for another post. It is Friday night after all.

Part of the Problem, not The Solution
I do not know what it is; perhaps a heady 75% stock rally off the lows, a general feeling that everything is guaranteed, or just good old fashioned grandstanding but it seems the victory lap tour is gaining steam across the financial world. The FED, Treasury, President, and many writers have taken time over the last month to preen in the glory that is a stock market rally as if that was all there was in the world. Which is fine, when you have one thing going for you you tend to highlight it.

What has rubbed me the wrong way today was a series of articles by Barry Ritholtz, who pens The Big Picture (TBP) blog, that are not only a victory lap of sorts but serve as an illustration of what ails the system we have.

Leading off, TBP notes:
Retail, Jobs Suggest Stronger Recovery
Highlights include better than expected (by whom?) same-store sales and some job growth data. This is fine, I know parsing the numbers to see the effect of massive store closings affecting the same store sale numbers (see Kid Dynamite and Mish here) is not a big deal if you are headline watching, so no big deal. My aggravation starts near the end with this:
The data continues to impress, yet many people are fighting both the economic numbers and the tape. Professionals who miss a 75% generational rally risk losing clients and assets. The danger for both bulls and bears is bringing their bias to the table, and missing the risk or the opportunity of the moment.
The data is impressive? Impressing who? Anyways, what was with the quip about missing the 75% move? I have no idea. I was willing to chalk it up to "whatever" but TBP ends with this:
I still expect a 20-30% correction — eventually — but until the market internals get uglier, our bias remains to the long side . . .
Huh?
Everything is getting better but the coming correction will be 20-30%? Confusing indeed. That is a weird type of recovery. Still, I have no idea what time frames TBP was talking about (he does not say) so it was a piece of information.

In the comments section some folks were pointing out the same store sales effect mentioned above as well as remarking on the enormous amount of FED/Treasury liquidity that has bought this "recovery". Some of the remarks were pretty nasty and I can understand that TBP may have been annoyed.

A bit later comes this post:
10 Psychological, Valuation, Adaptive Investing Rules
Most of it was "go against the crowd" kind of stuff but a few were pointed directly at the more bearish observers:
-After a a 55% market sell off, most of the terrible structural news that existed before the collapse is reflected in prices. (Let it go).
What is confusing here is that I have no idea what TBP means. Were stocks valued correctly with the SP500 at 700? If they were and that was indicative of the structural issues in the economy, things are 75% better now? The banks are that much better off? Really?

-Market Pros simply cannot afford to sit out a 75% rally; Individuals that miss that sort of move should reconsider their investment strategies immediately
There is that "get with the guys that bought his rally" speech again? Looking for new clients? I have no idea. While TBP manages money for big players I would submit most small timers rode the entire 75% move up along with the smart guys, they just also rode the 50% down wave first!

These two caught my eye as TBP is a huge believer that markets can see ahead:
-Whether a premise is fundamentally true or false is irrelevant as to whether it is actionable. If enough fools believe something is so, it will impact the markets
-The markets frequently diverge from the macro economic environment. This can be both long lasting and maddening; Your job is to be aware of how wide the gap between the two is
So which is it? The market is smart or the market is dumb? Both at some times? Again, not consistent at all.

To end the day we got this one:
Buy What You Hate (WTF?)
TBP notes that buying Citigroup, Bank of America, and Fannie Mae was/is a bold way to make a trade. While true, I was pegged at redline on the annoyance meter.

Part of the problem with Wall Street and our whole investment/gambling culture is the chasing of money at all costs. Here we have a writer that penned a book entitled "Bailout Nation" (which I read and recommended) which detailed the moral hazard that comes with government salvation of markets when they screw themselves. To turn around and join hands with that process to make a buck is indeed profitable, but just feels wrong.

A monkey throwing it's own poop through a cage at the stock ticker section of the newspaper is up 75% from the March lows. At least he could not use leverage! Everything is up and even Pets.com is coming back with an IPO (kidding, for now!). I mean BFD. A few Trillion spent has that effect.

Like zombies walking around moaning "Brains, we need brains to eat!" investment players are moaning "returns, we need returns!" Saddle the taxpayers losses for years via Fannie Mae? Buy FNM, it's backstopped! Citigroup is the worst bank in the world? It went from $2 to $3, $4 is on the way!

In my article on the Panic 1907 I noted that people fled a set of banks because the brother of one of the CEO's was involved in a failed short squeeze that lost big money. No one then wanted a part of that kind of stigma. Today we line up for the bailout and buy shares. Nothing is going to change.

As far as "fighting the tape" I would hope everyone has stopped that a long time ago. I have no positions right now (other than my long term metal portfolio), but I made out pretty good in 2009 and I did not buy one share of the bailout crowd to do it. I was not up 75%, but I also did not contribute to the flawed scam that is our "free" markets. To me a buck is not everything.

It's Friday Night Live!
Well that ran a bit long! Off to the fun!

Picture Comedy Relief
Some laughs to start out.

Yes, cats are indeed this smart:
funny pictures of cats with captions
see more Lolcats and funny pictures

This must be for medicinal purposes:

Nice!

Quiz Time
Take short quiz to find out:
What is your Superpower?
Mine was "invisibility". That would be sweet!

The "How Crazy are You" test seems useful. Big shock, I am "Kind of Crazy". Like I needed a quiz!

Quiz 3: Who remembers "The Dark Crytsal"??

Rock Blogging
Some music to get you started this weekend on the right note, pun intended!

A request from an indirect source was for the classic rock cover of "I Heard it Through the Grapevine" which I have to think was the Creedence Clearwater Revival version, which rocks:
Was that the version?

There were some Madonna requests! I actually like plenty of Madonna tunes. I used to wait for the video for "Open Your Heart to Me" for the alluring fishnets..., I mean lyrics and vocal work, lyrics and vocal work! Anyways, my favorite song is "Live to Tell" but I thought a more party time tune would be "Into the Groove":

And yes I have heard "La Isla Bonita". Who has not?

Sticking with the ladies, let's try "Girls Just Want to Have Fun" by Cindi Lauper:

See, I can do non metal songs!

My dad used to play this song on a 12 string guitar and it was awesome. Try out Kenny Rogers and "Ruby":


You know, doing these posts for years has limited the music left to play. I try to search my blog before I post a song to make sure I have not played it recently (I try for over a year, but make exceptions). How many really wonderful songs are there that I can play? I guess a lot, but I do get a block some times. Lets see what we can do.

I always loved Duran Duran's song "Ordinary World", here is a nice live version:

Not bad.

One more? Two more? Well I guess two for the road and all.

A little Tone Loc? Get loose with "Wild Thing":

You know you love it.

Last call! Have a drink? Check. Have a plan? Close enough.

Come on! You know I am closing with an 80's rocker tune! Get wild with Skid Row and "Youth Gone Wild":

Wundaful! Close second for the close was Tesla and "Signs".

Have a good night.

Thursday, April 8, 2010

Where Did All this Shadow Inventory Come From?

Thursday at last! I get Friday off from the boxing training and thus there will be Friday night Entertainment. Get your requests in, we had quite the mixed bag last week and it was fun.

How You View Things
There has been a flurry of talk about a possible Value Added Tax coming our way. I am going to probably blow some minds right now and maybe generate some nasty comments, but I am actually not against the VAT overall. Now do not get me wrong, I am against taxes in all forms at all times (and I am well versed with all the negative aspects of this tax), but at least this one is going to target everyone that buys stuff, including the 50% of the country that pays zero income taxes. At least I can work with that. Add to this businesses will have to pay at all steps of the process and think how those amazing profits during this V-shaped recovery will be able to handle just that. I say go long tax accountants if it comes true.

That said, how you view things fits here because in it's simplest form the VAT is a subtle, tricky tax that goes unseen for the most part. That is why governments love them. Consider the following:

The Government spends too much and wastes way too much. We cannot expect them to change and we cannot vote them out because the next set of people do the same thing

How you view things puts you into one of two camps (I am simplifying, but in the end this is all there is to it):
A - We need to support various programs and if that comes with the price of the waste and corruption we must lie, beg, steal, and tax to get the money the government needs

B - The only way to get change is to starve the fools into default and we will start over

Where are you?

Where Did All this Shadow Inventory Come From?
Today brought word that retails sales were making a killing and blowing away expectations (who does these estimates anyway?). While rates of change make zero impression upon me (all that matters is what the final numbers are, not the rates of change) all the spending seems at odds with high unemployment and falling wages. From Yahoo Finance we get this dandy of a headline:
Shoppers hand retailers a basket of Easter cash
Poetic, just, and perfect for our times. Even better material in the story:
"There was a lot of talk about the frugality of the American consumer and that the recession taught people to save more," said Sherif Mityas, a partner in the retail practice at management consultant A.T. Kearney. "But U.S. consumers have short-term memories."
Never a more apt description of what ails us.

So where is all this cash, plastic, or whatever coming from? I really have no idea. I would guess unemployment checks that run for all time help, but that does not seem quite right. Home equity extraction? Ha, kidding. Maybe an alternative form of mortgage money extraction? Like, not paying your mortgage:
Are Strategic Defaults Fueling Consumer Spending?
It wasn’t until this past week when a colleague mentioned the term strategic default did I realize what was likely occurring. Many consumers are spending their mortgage payments! It’s beginning to make sense in the most disturbing way. As homeowners face staggering payments on houses that have negative equity, a large number are simply deciding not to pay their mortgage bill, resigned to the fact that eventually they will lose their house.

And what happens with the money that would have been sent to the lenders? Well, an increasing mentality of “eat drink and be merry – for tomorrow we’re evicted” has set in.
There is more in the article.

I have to say I cannot believe that enough people are not paying their monthly mortgage to goose auto/electronics/other retail sales very much. I just do not think the numbers add up. I could be wrong.

And it appears that I might be.

If this story has merit, suddenly the numbers do start to add up:
Bank of America to Increase Foreclosure Rate by 600% in 2010
You did read the title right. How's that for a rate of change you rate of change fetish freeks out there!

From the story:
I attended a local Building Industry Association conference on Friday 26 March 2010. The west coast manager of real estate owned, Senior Vice President Ken Gaitan, stated that Bank of America, which currently forecloses on 7,500 homes a month nationally, will increase that number to 45,000 homes per month by December of 2010.
After his surprising statement, two questioners from the audience asked questions to verify the numbers.

Bank of America is projecting a 600% increase in its already large number of monthly foreclosures.

This isn't unsubstantiated rumor; this comes straight from one of the most powerful men in Bank of America's OREO department (yes, that really is what they call it). It appears they have too many properties already.
Wow, just wow.

Of course there are many that have argued the "shadow inventory" story was way overblown. Try that now.

There are many saying housing has bottomed. How does that look?

I have heard time and again that banks are on the mend and their books are not as bad as I would portray them. OK.

It is obvious that banks have been sitting (squatting?) on homes in foreclosure, without the foreclosure part. The tales of 2 years payment free may well be very true. Could this possibly help things like sales? I could be persuaded at this point!

Along these lines, an example. If you have not been reading the comments section, you are missing plenty. Loyal reader Gawains is an experienced real estate professional that knows the ins and outs of the business. From the last comment thread:
Today was repo day. There were probably, oh I don't know, 500 foreclosure sales on the courthouse steps. So we should be getting a lot of new assignments over the next few days. What fun that will be.

Want to know what I did this afternoon? Well, we got a request for a full interior price opinion and repair addendum on a repossessed home listed with another company. The company is thinking of transferring it to us because it hasn't sold. Current list price, $175,000.

Now, this house happens to be in one the nicer, established neighborhoods in north McAllen. Great location, good schools, easy access to main roads and shopping. 5 bedrooms, 4 baths, 3500+ sf, wood fence, in-ground pool. So I went over there to check it out.

Oh, my God. It's been completely stripped! All the lights, all the interior doors are gone. So are the appliances, the a/c unit and the pool equipment. The granite counters in the kitchen are ripped out, and all the cabinet doors are gone. Same for the built-ins and bathroom vanities. But this is what really gets me. They took all the drawers too.

Drawers? Why would you steal drawers? I mean, it's not like you can just slide them into another cabinet. You'd have to build new cabinets specifically to fit the drawers! It doesn't make any sense.

If there's one thing I hate more than a thief, it's a stupid thief.

So, I'm looking at about $35,000 in repairs at least. A typical homebuyer cannot purchase this house. It's not fit to live in. Only a professional investor with a lot of capital can buy something like this.

Calling all flippers, calling all flippers. Oh, sorry, I was having a flashback.
I cannot believe $35k makes that house whole again, but maybe he gets deals.

This is what is going on folks. You will not see it in CNBC. You will never, ever see Ben Bernanke have to address something like this at one of his dog and pony shows at the Senate. Want a glimpse at how bad things were at the top? Gawains offers:
I see this all the time. Here's how the scam works.

No credit? No problem! You too can buy a house. No down payment? No problem! We can give you a 0% down, interest-only ARM, and roll over the closing costs. It will cost you practically nothing.

Oh, and you'll need furniture. No money? No problem! You can completely furnish your new house with no down payment and no interest for a year.

So what these people do is fill out some paperwork. They can even lie bald faced, since no one really cares. They move into the house and furnish it. They do not make a single payment. What does it cost them? Utilities and food for a few months.
Then, when they get the first default notice, they just rent a moving truck, load up the furniture, strip the house, and disappear.

Great way to renovate and refurnish a house in Mexico, where you cannot be prosecuted since the crime occurred in America.

You guys have no idea what I deal with. And frankly, to tell you the God's honest truth, I'm more than disgusted.

Two years ago I got this assignment on a ranch house out in the middle of nowhere. It had been completely gutted of course, but here's the thing. They left the back door open and the goats got in and shit all over the house!
And I have to walk through this mess, while taking pictures and making notes.

Then I get this phone call from a contractor who wants to get into the business of cleaning repossessed homes. Oh, really? You want to clean a home? I got a home for you to clean.

After he had shovelled all the goat shit out of the house, it was a four-foot mound in the front yard that had to be hauled off.
Needless to say, he never called me for another cleaning again.
Talk about closing the barn door after the goats have left!

Going back to my intro question, where are you now?

Have a good night.