Last night I entered a DNA sequence that when translated into single letter amino acid code spelled out the header of a blog post section. The sequence was:
TTTCGCATTGACGCCTACAACATAGGCCACACCATGATACGGACGCACTGA
If you use the Wiki page for Genetic Code there is a handy dandy translation chart. Please note the chart uses the RNA codons which do not use the DNA base T, but another base U. I did not want to make things any more complicated. Anyways, here is the translation:
TTT - CGC - ATT - GAC - GCC - TAC
-F------R-------I--------D-----A------Y
AAC - ATA - GGC - CAC - ACC
-N------I------G------H------T
ATG - ATA - CGG - ACG - CAC - TGA
-M------I------R------T------H------PERIOD (STOP)
That's it, Friday Night Mirth!
I know, pretty lame but I had fun with it.
Have a good weekend.
Saturday, February 28, 2009
Friday, February 27, 2009
Long Week Comes To an End
This week seemed like it was a month long. So much going on in the world of finance. Super busy at work. I am with Capitalist Preservation in the idea that tonight and this weekend we should all lighten up and have a little fun. Huge snowstorm coming for Us on Sunday and into Monday, so I may even get a 3 day weekend out of the deal!!
Gold Observations
Yesterday I noted the action in gold over the past week seemed forced by short sellers and overall dumping at the 10am market open in New York. Even with this kind of pressure, gold held up well. As I am a computer illiterate and I have only so much time to make a post in a given night, I hardly ever can put together (that rhymed!) charts and all the bells and whistles other writers can. Luckily, if you wait a couple of days someone will do all the heavy lifting for you! This Minyanville article has graphical details on what I was seeing (below is text only):
I love gold in a macro sense so I am not too concerned about day to day changes. I wanted to highlight this article because it captured perfectly the action I was seeing.
Another Automatic Earth Thought Provoker
I admit that I look forward to reading the daily missives of the blog Automatic Earth. Today's is a really good one to get you thinking, so you may want to leave it for Monday! Full post here.
Brutal Honesty from the Brits
While I have NEVER understood most British humor, I do admire the honesty and up front manner the Brits do things. It seems that even their elected officials are not immune to telling it like it is! Imagine the concept!
Please consider the following admission:
When I write that the bailouts and backstops will have no end, and even that by design they are revolving doors people say "Hey, Economic Disconnect, surely there is an end to the amount that can go into all this stuff!". Mr. King just spelled it out for you. Notice that he did not say "if the banks need capital larger than X, then we will have to seek alternate plans". No he just said there is no way to know how much it will take, but he is ready to give!
From further in the article, check out this line:
A million miles may be closer than you think Mervyn my man!
5'-TTTCGCATTGACGCCTACAACATAGGCCACACCATGATACGGACGCACTGA
The spell checker for Blogger is working. After a week where I looked at literally over one hundred thousand bases during my DNA gene construction efforts I have progressed to the point at which I am seeing letters spelled out DNA bases! Let me explain.
Greatly simplified; three bases of DNA make up what is called a codon for an specific amino acid. These amino acids are strung together to make proteins, these proteins in turn make YOU. As I work at the DNA level the three bases represent a letter that stands for the particular amino acid they call for. There are 4 bases, A,T,G, and C and three of them make an amino acid.
Example: All eukaryotic genes start with the amino acid Methionine. That is every single protein is initiated with a methionine. The DNA bases for methionine are ATG. ATG = methionine. Methionine is designated a single letter code to make notation easier. Methionine has the letter code M. So ATG = M.
What I have done ,because I am a dork, is spell out the header for this section in DNA bases that when translated into their protein letters will give you the title of this section. It is not the title of the overall post (Long Week Comes To an End). If you have time to kill, try to figure it out. If not, I will post a translation tomorrow. Comes in handy as a cipher text as well!
Funny Commercial
When I saw this commercial this afternoon I laughed until my face hurt. It just cracks me up and I HAVE NO IDEA WHY! I am still chuckling:
Where is MY Pony?
Warning; Adult language in this cartoon, click only if you are not going to get offendedWith all the handouts you would think there would be a chicken in every pot, and a pony for every little girl. What happens when you are not one of the bailout winners? Here is your answer.
Star Wars Reference
If you know the scene referenced from Star Wars IV: A New Hope (original film) this picture will be very funny. If you are not familiar with the scene, it may not be funny:

Rock Blogging
Time to kick back, hear some tunes, and start the weekend!
A band I like is the Cranberries. My favorite song is called "Zombie". Haunting vocals, rich and deep baseline, and great lead guitar work all combine for a real treat:
Note: I understand this song has a political undertone to it, I am playing it because I love the song and have no commenatry on the politics it may reference.
I used to love this TV show when I was a lot younger called "Crime Story". The intro song was the timeless hit by Del Shannon "Runaway". Enjoy the song complete with a throwback "music video":
I had this song up a long time ago, but I was in the mood for the greatest Van Halen song ever! Please enjoy Halen at the height of their powers with a truly rock out tune called "Atomic Punk":
By now you all know I am an 80's hair band music addict! Along those lines enjoy White Lion with "Wait":
Last one for the evening. One of CCR's best songs (there are so many) is Green River and thus it will close the show:
Have a good night.
Gold Observations
Yesterday I noted the action in gold over the past week seemed forced by short sellers and overall dumping at the 10am market open in New York. Even with this kind of pressure, gold held up well. As I am a computer illiterate and I have only so much time to make a post in a given night, I hardly ever can put together (that rhymed!) charts and all the bells and whistles other writers can. Luckily, if you wait a couple of days someone will do all the heavy lifting for you! This Minyanville article has graphical details on what I was seeing (below is text only):
Short Squeeze for Gold?
Despite yesterday’s decline in the gold price, Gold ETFs' (GLD) gold holdings rose a third of a tonne to just over 1029 tonnes and another new all-time high.
Yesterday, COMEX open interest rose by a touch again on Wednesday -- to 373,339 contracts -- despite the sharp decline in the gold price. Which suggests once again that the decline was primarily the result of more heavy short selling by gold bears - and not bulls closing out longs.
In fact, if we look at the rate of growth in the shares outstanding of the 2x short gold ETFs (DZZ and GLL), you can see the rapid increase in the rate of new shorts that's occurred in just these 2 ETFs over the past couple of weeks.
Both of these ETFs get their 2x short exposure to gold by shorting the metal in the futures market.
Given that the GLD ETF hasn’t sold an ounce during this decline (and actually added a little yesterday), this is the setup for a huge short squeeze wherever this 4-day decline in gold terminates. Yesterday’s dip back to what was the October high and the ensuing reversal to end on the highs may just have signaled we’ve hammered out a low for this decline.
I love gold in a macro sense so I am not too concerned about day to day changes. I wanted to highlight this article because it captured perfectly the action I was seeing.
Another Automatic Earth Thought Provoker
I admit that I look forward to reading the daily missives of the blog Automatic Earth. Today's is a really good one to get you thinking, so you may want to leave it for Monday! Full post here.
Brutal Honesty from the Brits
While I have NEVER understood most British humor, I do admire the honesty and up front manner the Brits do things. It seems that even their elected officials are not immune to telling it like it is! Imagine the concept!
Please consider the following admission:
Mervyn King: 'Impossible to say' how much capital needed to shore up banking system
Mr King said it would take "many months" to establish the scale of toxic assets held by banks, and the scale of problems would change depending on the international economic outlook.
Giving evidence to the Treasury Select Committee, Mr King said it was vital to "find out what is really on the balance sheets of our major banks".
"That is not something that is easy to do or can be done quickly," he told the MPs. "It will require a much longer and more detailed assessment contract by contract."
He went on: "It will certainly take many months in my view."
Mr King said the state of the global economy would have a huge impact on the situation of struggling UK financial institutions.
"How much capital banks will need in the end is impossible to tell," he added
When I write that the bailouts and backstops will have no end, and even that by design they are revolving doors people say "Hey, Economic Disconnect, surely there is an end to the amount that can go into all this stuff!". Mr. King just spelled it out for you. Notice that he did not say "if the banks need capital larger than X, then we will have to seek alternate plans". No he just said there is no way to know how much it will take, but he is ready to give!
From further in the article, check out this line:
"I do think public debt matters. We get to this crisis with levels of public borrowing which were too high and that made it difficult," he said.
But, he added, that was a "million miles" away from the idea that Britain in any way resembled somewhere like Zimbabwe.
A million miles may be closer than you think Mervyn my man!
5'-TTTCGCATTGACGCCTACAACATAGGCCACACCATGATACGGACGCACTGA
The spell checker for Blogger is working. After a week where I looked at literally over one hundred thousand bases during my DNA gene construction efforts I have progressed to the point at which I am seeing letters spelled out DNA bases! Let me explain.
Greatly simplified; three bases of DNA make up what is called a codon for an specific amino acid. These amino acids are strung together to make proteins, these proteins in turn make YOU. As I work at the DNA level the three bases represent a letter that stands for the particular amino acid they call for. There are 4 bases, A,T,G, and C and three of them make an amino acid.
Example: All eukaryotic genes start with the amino acid Methionine. That is every single protein is initiated with a methionine. The DNA bases for methionine are ATG. ATG = methionine. Methionine is designated a single letter code to make notation easier. Methionine has the letter code M. So ATG = M.
What I have done ,because I am a dork, is spell out the header for this section in DNA bases that when translated into their protein letters will give you the title of this section. It is not the title of the overall post (Long Week Comes To an End). If you have time to kill, try to figure it out. If not, I will post a translation tomorrow. Comes in handy as a cipher text as well!
Funny Commercial
When I saw this commercial this afternoon I laughed until my face hurt. It just cracks me up and I HAVE NO IDEA WHY! I am still chuckling:
Where is MY Pony?
Warning; Adult language in this cartoon, click only if you are not going to get offendedWith all the handouts you would think there would be a chicken in every pot, and a pony for every little girl. What happens when you are not one of the bailout winners? Here is your answer.
Star Wars Reference
If you know the scene referenced from Star Wars IV: A New Hope (original film) this picture will be very funny. If you are not familiar with the scene, it may not be funny:

Rock Blogging
Time to kick back, hear some tunes, and start the weekend!
A band I like is the Cranberries. My favorite song is called "Zombie". Haunting vocals, rich and deep baseline, and great lead guitar work all combine for a real treat:
Note: I understand this song has a political undertone to it, I am playing it because I love the song and have no commenatry on the politics it may reference.
I used to love this TV show when I was a lot younger called "Crime Story". The intro song was the timeless hit by Del Shannon "Runaway". Enjoy the song complete with a throwback "music video":
I had this song up a long time ago, but I was in the mood for the greatest Van Halen song ever! Please enjoy Halen at the height of their powers with a truly rock out tune called "Atomic Punk":
By now you all know I am an 80's hair band music addict! Along those lines enjoy White Lion with "Wait":
Last one for the evening. One of CCR's best songs (there are so many) is Green River and thus it will close the show:
Have a good night.
Thursday, February 26, 2009
None of This Makes Any Sense!
It will be in the high fifty degree range here tomorrow. It is going to rain, but 50 degrees after a bad winter feels good no matter what.
Odyssey Marine Exploration Show
The company with the ticker OMEX has so far been a bust as an investment. There is still time to impress me, but unless they are setting up some grand finale I would say no. Still their TV show on Discovery Thursdays at 10pm are great entertainment. This evening the crew will check out the historic RMS Lusitania, and if you know your history I need not detail the significance of the ship. There is no "treasure" to be had, but perhaps an answer to a long held question in history: Two torpedoes, or one?
Full Disclosure: I own OMEX shares.
Just Plain Wrong
Recently many of my posts have been angled to a "right vs. wrong" kind of thing. I hate to do those kinds of things because what is right for some is not for others, bla bla bla... and all that moral ambiguity crap. I still feel that in a reasonable person's mind they KNOW right from wrong.
As usual, another writer puts my sentiments into words better than I can, and so I recommend the entire post from today's Automatic Earth blog. I will excerpt below, but be aware that after the intro commentary there are a ton of news stories so the page is very long!
Excerpt:
Exactly!
How About an AIG Press Conference?
Our president has been on TV just about every day since November 4th. Not just as in a "cameras saw the president.." kind of thing but full blown speeches or press conferences called by him and his staff. Well if Mr. Obama is not too busy next week I sure would appreciate 10 minutes of his time, I am sure all the networks will carry it, to explain WHY IN THE HELL THE GOVERNMENT IS GOING TO BACKSTOP AIG CDS EXPOSURE!!!!:
So President Obama's weekend assignment to to put together an explanation of:
1.) What is a CDS?
2.) Why is the government giving an open ended taxpayer commitment to any and all losses on them?
Seeing that Mr. Obama is about 100X smarter than George Bush, I imagine this will be no sweat. He can even ask Ross Perot for some charts.
I am serious. If the president wants to talk to us every day, at least talk about something important. I am waiting for change I can believe in.
None of This Makes Any Sense!
The deluge of bailouts, backstops, tax hikes and budget proposals were so severe today I was a bit confused. I thought it was the sheer volume of information that was causing me to be a little fuzzy on the conflicting information. Now that I have had a little time to read over some material, I must admit total bewilderment. I have no idea who is putting this stuff together, but it is not funny (well a little bit) and it is very damaging long term.
-There was just a mortgage bailout plan announced and then today the mortgage interest deduction option is stripped out in the new budget? Granted it is for the ultra rich-those making over a whopping $208k a year combined-but really what a way to crater home sales even further. Side note: $208k combined is not much in most of California, New York, Massachusetts and many other places. That is not "ultra rich".
-Tax increases for businesses after they just allowed aggressive carry loss forward provisions for business. How are they going to pay more when they can use losses even more aggressively to, you guessed it, cut their tax bills? Never mind the debate about hiking taxes in a recession, the cancelling out of policy is confusing.
-Higher capital gains taxes for private citizens when there are NO GAINS to tax! After a 50% market meltdown I doubt the tax returns are going to be stuffed with anything except, you guessed it, loss provisions. Again, wildly crazy!
-The budget assumes the whole crazy carbon credit swindle will pass as law. This dumb legislation is going to be a hot button issue, even among democrats. To assume it passes AND adds 500 Billion in revenue to a budget before it has even started debate is a brazen action.
There was plenty more but my head is spinning (You spin me right round, baby right round) and I am going to puke. While I have always assumed the government was operating with the worst and the dimmest of what the country had to offer in terms of personnel, events of the last 2 years have shown me to be correct.
It is obvious that the budget estimates are too optimistic as to what kinds of revenues they are going to collect. I fully expect the tax hikes to extend to anyone making over $50k and the mortgage deduction to be revoked for all. For the record I am for the mortgage interest deduction being removed. The government has no place favoring by tax policy home buying over renting. None at all. Expect this little tidbit to get people you know all upset, many cling to the idea that the mortgage interest deduction is the single greatest thing in the world (except Friday Night with Economic Disconnect, or so I hear).
Things are moving fast. It is my belief that the most harmful and dangerous legislation is being rushed out the door as fast as possible using the economic mess as cover. Most policies I saw today will run high opposition, and no, not just from republicans. I think "Tea Party Locations" will become the Google most searched term before long. Of course, pretty soon it will be too late as all this stuff will be passed.
Trillion dollar deficits as far as the eye can see, perpetual bailouts, backstops for contracts that have no bottom, and policy that ensures reduced tax revenue are a recipe for many things and none of them good. Gold is being aggressively shorted right now as it is the only thing that has gone up. Right at the NY market open at 10am for a week a huge sell block has been issued (Central bank? Which one or ones?) on gold which pushes the price down. There is a line of thinking that as other currencies and markets get worse than the US markets and the dollar that gold will get crushed. Reread the first sentence of this paragraph. If the US situation is going to be the best of the lot, how is that bad for gold? Besides, it's pretty!
Full Disclosure; I own gold miners GG and KGC
Have a good night.
Odyssey Marine Exploration Show
The company with the ticker OMEX has so far been a bust as an investment. There is still time to impress me, but unless they are setting up some grand finale I would say no. Still their TV show on Discovery Thursdays at 10pm are great entertainment. This evening the crew will check out the historic RMS Lusitania, and if you know your history I need not detail the significance of the ship. There is no "treasure" to be had, but perhaps an answer to a long held question in history: Two torpedoes, or one?
Full Disclosure: I own OMEX shares.
Just Plain Wrong
Recently many of my posts have been angled to a "right vs. wrong" kind of thing. I hate to do those kinds of things because what is right for some is not for others, bla bla bla... and all that moral ambiguity crap. I still feel that in a reasonable person's mind they KNOW right from wrong.
As usual, another writer puts my sentiments into words better than I can, and so I recommend the entire post from today's Automatic Earth blog. I will excerpt below, but be aware that after the intro commentary there are a ton of news stories so the page is very long!
Excerpt:
Rudderless Bathtubs
You don't have to be a teacher of morals to know that some things are just plain wrong. And in our societies these days, a lot of things are plain wrong. Morally wrong, legally wrong, politically wrong, economically wrong.
The Royal Bank of Scotland this morning announced the biggest corporate loss in British history. Its stock, however, shot up 20-25%. The reason for that was another announcement, this one by the UK government, that RBS will be allowed to place over $1 trillion in toxic assets in government insured vehicles. What this means is that private shareholders have the opportunity to make a lot of money over the backs of taxpayers. The government is majority stockholder in RBS, but still allows speculation and profit taking with RBS shares. It's simply completely wrong, and an unforgivable piece of policy. RBS should have been placed in bankruptcy, the government should have taken over its assets, and shareholders and bondholders should have been wiped out 100%. All executives should have been fired without severance packages or pensions. Instead, former chief Sir Fred Goodwin, responsible for all losses, is set to receive a $925,000 pension per year.
In the US, Bank of America and Citigroup should have been taken over, wiping out share- and bondholders. It's not called risk capital for nothing. The taxpayer never accepted the risk willingly, but is burdened with it. Those who did accept it, can sell and walk away free. Wrong. Companies like AIG and RBS are still free to make multi-billion dollar decisions without consulting the governments without whose money they would have ceased to exist. Wrong.
Exactly!
How About an AIG Press Conference?
Our president has been on TV just about every day since November 4th. Not just as in a "cameras saw the president.." kind of thing but full blown speeches or press conferences called by him and his staff. Well if Mr. Obama is not too busy next week I sure would appreciate 10 minutes of his time, I am sure all the networks will carry it, to explain WHY IN THE HELL THE GOVERNMENT IS GOING TO BACKSTOP AIG CDS EXPOSURE!!!!:
AIG Rescue May Include Credit-Default Swap Backstop
Feb. 26 (Bloomberg) -- American International Group Inc. may get a backstop from the U.S. to protect against further losses on credit-default swaps, according to a person familiar with the matter.
The federal guarantees may be included in New York-based AIG’s restructured bailout, which the company plans to disclose next week with fourth-quarter results, according to the person, who declined to be identified because the talks are private.
Regulators who saved AIG in September feared that a collapse of the insurer, which sold swaps to banks including Goldman Sachs Group Inc., would spread losses throughout the global financial system. In November the U.S. committed $30 billion to retire some of the contracts tied to subprime mortgages, while not addressing other swaps tied to corporate loans and European debt.
“Counterparties around the world continue to have significant exposure to AIG, and market conditions continue to be fragile and sensitive to the potential disorderly failure of AIG,” the Federal Reserve said in a report in November.
So President Obama's weekend assignment to to put together an explanation of:
1.) What is a CDS?
2.) Why is the government giving an open ended taxpayer commitment to any and all losses on them?
Seeing that Mr. Obama is about 100X smarter than George Bush, I imagine this will be no sweat. He can even ask Ross Perot for some charts.
I am serious. If the president wants to talk to us every day, at least talk about something important. I am waiting for change I can believe in.
None of This Makes Any Sense!
The deluge of bailouts, backstops, tax hikes and budget proposals were so severe today I was a bit confused. I thought it was the sheer volume of information that was causing me to be a little fuzzy on the conflicting information. Now that I have had a little time to read over some material, I must admit total bewilderment. I have no idea who is putting this stuff together, but it is not funny (well a little bit) and it is very damaging long term.
-There was just a mortgage bailout plan announced and then today the mortgage interest deduction option is stripped out in the new budget? Granted it is for the ultra rich-those making over a whopping $208k a year combined-but really what a way to crater home sales even further. Side note: $208k combined is not much in most of California, New York, Massachusetts and many other places. That is not "ultra rich".
-Tax increases for businesses after they just allowed aggressive carry loss forward provisions for business. How are they going to pay more when they can use losses even more aggressively to, you guessed it, cut their tax bills? Never mind the debate about hiking taxes in a recession, the cancelling out of policy is confusing.
-Higher capital gains taxes for private citizens when there are NO GAINS to tax! After a 50% market meltdown I doubt the tax returns are going to be stuffed with anything except, you guessed it, loss provisions. Again, wildly crazy!
-The budget assumes the whole crazy carbon credit swindle will pass as law. This dumb legislation is going to be a hot button issue, even among democrats. To assume it passes AND adds 500 Billion in revenue to a budget before it has even started debate is a brazen action.
There was plenty more but my head is spinning (You spin me right round, baby right round) and I am going to puke. While I have always assumed the government was operating with the worst and the dimmest of what the country had to offer in terms of personnel, events of the last 2 years have shown me to be correct.
It is obvious that the budget estimates are too optimistic as to what kinds of revenues they are going to collect. I fully expect the tax hikes to extend to anyone making over $50k and the mortgage deduction to be revoked for all. For the record I am for the mortgage interest deduction being removed. The government has no place favoring by tax policy home buying over renting. None at all. Expect this little tidbit to get people you know all upset, many cling to the idea that the mortgage interest deduction is the single greatest thing in the world (except Friday Night with Economic Disconnect, or so I hear).
Things are moving fast. It is my belief that the most harmful and dangerous legislation is being rushed out the door as fast as possible using the economic mess as cover. Most policies I saw today will run high opposition, and no, not just from republicans. I think "Tea Party Locations" will become the Google most searched term before long. Of course, pretty soon it will be too late as all this stuff will be passed.
Trillion dollar deficits as far as the eye can see, perpetual bailouts, backstops for contracts that have no bottom, and policy that ensures reduced tax revenue are a recipe for many things and none of them good. Gold is being aggressively shorted right now as it is the only thing that has gone up. Right at the NY market open at 10am for a week a huge sell block has been issued (Central bank? Which one or ones?) on gold which pushes the price down. There is a line of thinking that as other currencies and markets get worse than the US markets and the dollar that gold will get crushed. Reread the first sentence of this paragraph. If the US situation is going to be the best of the lot, how is that bad for gold? Besides, it's pretty!
Full Disclosure; I own gold miners GG and KGC
Have a good night.
Wednesday, February 25, 2009
Ben Bernanke Breaks the "Fourth Wall"
How was that for one news day? Twists, turns, and abrupt stops were all over the place today. I will try to make a little sense of the things I was watching, but feel free to chime in!
Blogroll Additions
Two new additions to report.
One of my long time favorite blogs is Housing Doom. Tons of great analysis and wonderful color commentary. The posting frequency has gone up as of late, and I always stop by.
The other is Capitalist Preservation. A new site run by a friend to this blog, the material is real time breaking information that comes in handy if you are busy at work and need the important headlines.
Enjoy!
Remember, It Will Never End
To try and frame what the theme of the post tonight will try and make clear I want to start off by highlighting two examples of how government bailouts using taxpayer (and way more than that) money, once started, can never, ever stop. The first clear example is the AIG debacle where the insurance firm continues to come back to the well for more money almost monthly. Will it ever end?
The second example comes from the Mortgage Relief Bill proposed by Obama last week that even as it has yet to be instituted, is already being geared up for an expansion of terms. Remember that I wrote here that few people would qualify due to the 105% loan to value restriction? Well, it seems some others have the same qualms about saving taxpayer funds, and thus that tidbit must be changed and pronto!:
So there you go. We will not reward speculators or gamblers. Oh wait, maybe we will!
Metaphors Have Limits
from the mentioned site Housing Doom came this exchange form Ben Bernanke's testimony today where he uses a stupid metaphor to describe mortgage bailouts:
Metaphors have limits, and Bernanke's was a weak one to use. At least he is consistent with using imagery of fear and pain. It is not quite "tanks in the street" but it is your entire neighborhood burning down. Not sure where Big Ben lives, but there is no way any of my neighbors homes burning could touch mine unless they had a meth lab inside when it went up!
Stress Tests Revealed as Blank Checks
You know I got snookered. I actually believed that the so called "stress tests" were going to identify those banks too impaired to keep playing and that there would be at least a couple of sacrificial lambs put out of their misery. Well, as the band The Who likes to sing "We won't get fooled again!"
It turns out the "stress tests" are nothing more than figuring out how large a check will have to be written out to prop up the largest banks. That's it. That's all. Calculated Risk has a TON of charts showing the parameters of the so called tests (basically optimistic and slightly pessimistic scenarios) and if the details interest you, I direct you there. There are many details that are galling, like the price point in time reference for converting preferred shares to common set at the average of the 19 trading days prior to February 9th. I am serious, they actually came up with that!
What I would highlight is that even the reports on the tests admit they are not actually tests in the pass/fail sense, but estimates of how much cash the banks will get:
I love that "private funds" line. Like that Saudi Prince, who bought all those Citi shares only to get massacred, will pony up another fortune to go bye bye. As if. More article:
How are they going to force reality to the surface without releasing the information?
Take home point: I was fooled. This is no test, just a rough estimate of a huge bailout that is structured as to not result in nationalization per say, nut really it is in practice. Also, the banks can keep on coming back for more as long as they need. Makes me think of the film "The Neverending Story".
Ben Bernanke Breaks the "Fourth Wall"
During Ben Bernanke's testimony today he made the serious mistake of getting personal and acknowledging criticism pointed at the FED. Historically FED heads are aloof, detached, speak in clever riddles, and accept no blame. Ben must really be under pressure to have made this quip today:
Oh man. When you know what you are doing and it is yielding results there is no need to tell everyone that you know what you are doing. I found Bernanke's quote today very revealing.
I understand that the powers that be are under enormous strain. I applaud that they are working extremely hard and probably long hours to get things done. My main gripe is that they would better serve the US by stopping these silly stress tests and never ending bailouts and just force all the junk out in the open. Let the bodies hit the floor and what remains will begin anew. Just as it has always done.
Tonight we saw that the bailouts for the banks are now effectively open ended commitments. A while back I asked what would be too much money to throw into insolvent banks, 1 trillion, 5 trillion?, 10 trillion? Today we got an answer. The answer is clearly "We will let you know, we know what we are doing." Well, thanks gentlemen, now I feel much better.
Have a good night.
Blogroll Additions
Two new additions to report.
One of my long time favorite blogs is Housing Doom. Tons of great analysis and wonderful color commentary. The posting frequency has gone up as of late, and I always stop by.
The other is Capitalist Preservation. A new site run by a friend to this blog, the material is real time breaking information that comes in handy if you are busy at work and need the important headlines.
Enjoy!
Remember, It Will Never End
To try and frame what the theme of the post tonight will try and make clear I want to start off by highlighting two examples of how government bailouts using taxpayer (and way more than that) money, once started, can never, ever stop. The first clear example is the AIG debacle where the insurance firm continues to come back to the well for more money almost monthly. Will it ever end?
The second example comes from the Mortgage Relief Bill proposed by Obama last week that even as it has yet to be instituted, is already being geared up for an expansion of terms. Remember that I wrote here that few people would qualify due to the 105% loan to value restriction? Well, it seems some others have the same qualms about saving taxpayer funds, and thus that tidbit must be changed and pronto!:
Fannie/Freddie Refi's May Extend Beyond 105% LTV
The loan-to-value (LTV) limit on mortgages Fannie Mae and Freddie Mac will be able to refinance as part of Obama’s Homeowner Affordability and Stability Plan may go higher than the original 105 percent, according to National Mortgage News.
The info is based on remarks made by William Longbrake, a former FIDC and WaMu employee, and current member of the board at First Financial Northwest, at the National Association of Mortgage Brokers Legislative and Regulatory Conference in Washington.
He stressed he was speaking for himself and not the White House, but noted it was “entirely possible” the ceiling for GSE refis could rise above 105 percent once procedures were in place to refinance underwater loans.
Last week, FHFA director James B. Lockhart said the line was drawn at 105 percent so the loans could be securitized and also because of capacity issues.
So there you go. We will not reward speculators or gamblers. Oh wait, maybe we will!
Metaphors Have Limits
from the mentioned site Housing Doom came this exchange form Ben Bernanke's testimony today where he uses a stupid metaphor to describe mortgage bailouts:
Bernanke Does Not Get "Love Thy Neighbor"
I was in agreement with Rick Santelli of CNBC when he lamented that those who pay their mortgages are being saddled with subsidizing those that don’t. A lot of people were in agreement with Santelli- so many in fact that it brought a response from Federal Reserve chairman Ben Bernanke: [Thanks L!]
"You could punish him by refusing to send the fire dept and then he would learn his lesson, but unfortunately in the process you’d have the entire neighborhood burning down."
CNBC’s Michelle Caruso-Cabrera quoted a reader who gave the following response:
My neighbor was smoking in bed, his house did burn down, and half of my house was destroyed with it. The Fire Department hit the snooze button on the fire alarm several times, showed up late (house was fully engulfed and ready to collapse) and, had a squirt gun to fight the fire.
Cabrera’s response:
Now they are going to waste precious and expensive water (taxpayer money) by pouring it all over the embers.
To this I would add a slightly different view:
A relative has overextended themselves- a lot. They are in debt way over their head. You don’t have the resources to bail them out, and you would not do them any good in the long run if you did. Consequently, you let them take their financial lumps- you just make sure that they have enough to keep the kids fed and off of the streets.
My neighbor’s house is NOT on fire Mr. Bernanke- it’s just overvalued. Consequently, my neighbor has no money to go out and do all the spending that the government so desperately wants him to do. I’ve been renting for the past four years, waiting for house prices to come down so I can buy one without ended up like my neighbor. When his house goes into foreclosure, he moves into housing he can afford, and I can buy the house I’ve been waiting for. It sounds like a good plan to me, and you want to mess it up for both of us.
Sir, your testimony was biblical in it’s tone, with a Judge not, that ye be not judged, theme. (Matt 7:1) However I would prefer you read on a little further to Matt 19:19, Thou shalt love thy neighbor as thyself. That means ALL of your neighbors, and ALL of us need affordable housing- even if it hits the balance sheet of the banks.
Bernanke can’t prop this bubble up, and isn’t helping any of us by trying. Here’s hoping he figures that out before bankrupting all of us.
Metaphors have limits, and Bernanke's was a weak one to use. At least he is consistent with using imagery of fear and pain. It is not quite "tanks in the street" but it is your entire neighborhood burning down. Not sure where Big Ben lives, but there is no way any of my neighbors homes burning could touch mine unless they had a meth lab inside when it went up!
Stress Tests Revealed as Blank Checks
You know I got snookered. I actually believed that the so called "stress tests" were going to identify those banks too impaired to keep playing and that there would be at least a couple of sacrificial lambs put out of their misery. Well, as the band The Who likes to sing "We won't get fooled again!"
It turns out the "stress tests" are nothing more than figuring out how large a check will have to be written out to prop up the largest banks. That's it. That's all. Calculated Risk has a TON of charts showing the parameters of the so called tests (basically optimistic and slightly pessimistic scenarios) and if the details interest you, I direct you there. There are many details that are galling, like the price point in time reference for converting preferred shares to common set at the average of the 19 trading days prior to February 9th. I am serious, they actually came up with that!
What I would highlight is that even the reports on the tests admit they are not actually tests in the pass/fail sense, but estimates of how much cash the banks will get:
Big banks face 'stress tests' from regulators
WASHINGTON (AP) -- The Obama administration hopes to restore confidence in the nation's ailing financial sector by subjecting 19 of the largest banks to "stress tests" that will gauge whether each institution has adequate capital to survive a severe downturn.
Banks that need new funds will be given six months to obtain it from the private sector or, failing that, from the federal government's $700 billion bank rescue program, the Treasury Department said Wednesday.
I love that "private funds" line. Like that Saudi Prince, who bought all those Citi shares only to get massacred, will pony up another fortune to go bye bye. As if. More article:
Government officials haven't specifically said which banks will be subject to the tests, but under the government's criteria they would include large nationwide banks such as Citigroup Inc., Bank of America Corp., JPMorgan Chase & Co. and Wells Fargo & Co. The 19 largest banks hold two-thirds of the banking industry's assets.
Government officials hope the tests will boost market confidence in the banks by making it clear the institutions either have the necessary capital to weather a major downturn, or will obtain it from private investors or the government.
Bank regulators said they wouldn't release the tests' results, but the banks will likely make some disclosure of the outcome, particularly if it shows they don't need more capital. Banks that seek private capital likely will indicate how much they need and the government will announce any new investments.
Daniel Alpert, managing director of Westwood Capital LLC, an investment bank, said the stress tests will "force reality to the surface" by demonstrating that many large banks face increasing losses on commercial real estate and other assets. Westwood holds a small stake in Citigroup.
Administration officials did not say whether they expect to request more taxpayer money to fund the next round of investments in banks, beyond general statements that they would provide the capital that banks need.
How are they going to force reality to the surface without releasing the information?
Take home point: I was fooled. This is no test, just a rough estimate of a huge bailout that is structured as to not result in nationalization per say, nut really it is in practice. Also, the banks can keep on coming back for more as long as they need. Makes me think of the film "The Neverending Story".
Ben Bernanke Breaks the "Fourth Wall"
"Breaking the fourth wall" refers to a situation in which a character reveals his or her awareness of the audience.
During Ben Bernanke's testimony today he made the serious mistake of getting personal and acknowledging criticism pointed at the FED. Historically FED heads are aloof, detached, speak in clever riddles, and accept no blame. Ben must really be under pressure to have made this quip today:
Bernanke tells Congress Fed knows what it is doing
WASHINGTON (MarketWatch) - Federal Reserve Board Chairman Ben Bernanke tried to assure Congress and investors that federal regulators are not grasping at straws in the response to the financial crisis.
"We're not making it up," Bernanke told the House Financial Services panel.
"We're working along a program that has been applied in various contexts," he said. "We're not completely in the dark."
The sense that Washington was reacting to events rather than shaping them has grown since former Treasury Secretary Henry Paulson switched the focus on the first $350 billion in bailout funds he received from Congress last fall.
Bernanke said that the government was prepared to inject capital to fix holes in the banks caused to the sudden sharp drop in their assets. But the size of the holes remains an open question.
Oh man. When you know what you are doing and it is yielding results there is no need to tell everyone that you know what you are doing. I found Bernanke's quote today very revealing.
I understand that the powers that be are under enormous strain. I applaud that they are working extremely hard and probably long hours to get things done. My main gripe is that they would better serve the US by stopping these silly stress tests and never ending bailouts and just force all the junk out in the open. Let the bodies hit the floor and what remains will begin anew. Just as it has always done.
Tonight we saw that the bailouts for the banks are now effectively open ended commitments. A while back I asked what would be too much money to throw into insolvent banks, 1 trillion, 5 trillion?, 10 trillion? Today we got an answer. The answer is clearly "We will let you know, we know what we are doing." Well, thanks gentlemen, now I feel much better.
Have a good night.
Labels:
Metaphors Suck,
No End,
Stress Test Blank Checks
Tuesday, February 24, 2009
Krugman Losing Faith in Government Plans; Also News That Cats and Dogs Will Now Live Happily Together
Someday someone is going to be able to explain to me why Massachusetts drivers INSIST on being in the left lane of a rotary when they have to exit to the right and cut off several cars almost causing a pile up every time. I see this every day. It is a condition specific to Massachusetts. Home of MIT, Harvard, and stupid drivers the envy of the world.
Hilarious Rap Lyrics
I came across this amazingly funny post on the Yahoo Finance message boards for Bank of America (BAC) today. For the full effect you need to be familiar with the the rap song "I Like Big Butts" by Sir Mix-A-Lot:
Now substitute this writers lyrics and you have one funny tune! A sample:
Instant classic!
Read Tomorrows Headlines Today
What good is a financial site if it cannot predict the future? Here at Economic Disconnect I sympathize with the readers need to have some guidance for the future. Tonight I will dust off my crystal ball and deliver unto you the headlines from the future! Now where did I put that thing........
Ready?
In 2-4 months we will see the following headlines in all the mainstream media:
"Foreclosure Numbers Contract Sharply; Housing Bottom in Progress?"
"Foreclosures Drop at Record Pace; Now is the Time to Buy?"
"Homes Entering Foreclosure Drop; Proof Government Plans are Working"
Amazing, huh? Now how can I possibly see into the future (disregard my ability to use the force)? Simple, I can read and I can guess at how news will be spun. You are aware that BAC and C are suspending foreclosures until they get the bailouts they require through the mortgage bill. That is a lot of foreclosures that are going to go away from the count in the next few months. Also, California has led the way with their own bill to delay the inevitable by imposing a moratorium on foreclosures for 90 days! So do you think foreclosure numbers going forward are going to go up, or down? And how do you think this will be reported? Simple stuff this reading the future!
Ben Bernanke Says the Recession Will End in 2009, and 2010 Will be a Year of Recovery
I have nothing to add to that headline, it writes itself!
Krugman Losing Faith in Government Plans; Also News That Cats and Dogs Will Now Live Happily Together
Its is now official, I am very worried. When in the course of human events I find myself in the same boat as Paul Krugman you know something wicked this way comes!
My favorite Keynesian adherent had a blog post today that was honest and forthright without partisanship and cheerleading. Excerpt:
Welcome to my world Mr. Krugman!
Everything being done right now is all about buying time. And more time. The central belief is still that many of these dud debts are going to miraculously become good in the future. This flies in the face of everything we know. Is there something else? Something myself and even Mr. Krugman are missing?
The only thing I think can explain the "buy time" mantra is that the FED/Treasury know they are going to monetize this debt and devalue the dollar. Obviously this is going to take, what class?, that's right, TIME. The dollar having a huge rally lately only makes the need for TIME that much more pressing. The FED will want to gently devalue the dollar in small increments as to avert a panic. This will take TIME. When viewed through this lens, I think we may be closer to the answer.
If it comes down to the FED being able to orchestrate and orderly devaluation, I think they may be overconfident. Time will tell.
Have a good night.
Hilarious Rap Lyrics
I came across this amazingly funny post on the Yahoo Finance message boards for Bank of America (BAC) today. For the full effect you need to be familiar with the the rap song "I Like Big Butts" by Sir Mix-A-Lot:
Now substitute this writers lyrics and you have one funny tune! A sample:
Baby Got BAC
I like big BANKS and I cannot lie
You other traders can't deny
That when these stocks get down to an itty bitty price
it's time to roll the dice
And then SPRING,
Pull the trigger on the trade
Take advantage of the bear raid
The losses that I'm bearing
Won't stop me from getting more shares in
Oh Cramer! I take issue with ya
I get the picture
Your always trying to warn me
But your take on BAC is oh-so-corny
Instant classic!
Read Tomorrows Headlines Today
What good is a financial site if it cannot predict the future? Here at Economic Disconnect I sympathize with the readers need to have some guidance for the future. Tonight I will dust off my crystal ball and deliver unto you the headlines from the future! Now where did I put that thing........
Ready?
In 2-4 months we will see the following headlines in all the mainstream media:
"Foreclosure Numbers Contract Sharply; Housing Bottom in Progress?"
"Foreclosures Drop at Record Pace; Now is the Time to Buy?"
"Homes Entering Foreclosure Drop; Proof Government Plans are Working"
Amazing, huh? Now how can I possibly see into the future (disregard my ability to use the force)? Simple, I can read and I can guess at how news will be spun. You are aware that BAC and C are suspending foreclosures until they get the bailouts they require through the mortgage bill. That is a lot of foreclosures that are going to go away from the count in the next few months. Also, California has led the way with their own bill to delay the inevitable by imposing a moratorium on foreclosures for 90 days! So do you think foreclosure numbers going forward are going to go up, or down? And how do you think this will be reported? Simple stuff this reading the future!
Ben Bernanke Says the Recession Will End in 2009, and 2010 Will be a Year of Recovery
I have nothing to add to that headline, it writes itself!
Krugman Losing Faith in Government Plans; Also News That Cats and Dogs Will Now Live Happily Together
Its is now official, I am very worried. When in the course of human events I find myself in the same boat as Paul Krugman you know something wicked this way comes!
My favorite Keynesian adherent had a blog post today that was honest and forthright without partisanship and cheerleading. Excerpt:
Mysterious plans
I’m trying to be sympathetic to the various plans, or rumors of plans, for bank aid; but I keep not being able to understand either what the plans are, or why they’re supposed to work. And I don’t think it’s me.
So the latest is that we’re going to convert preferred stock held by the government to common stock, maybe. James Kwak has a good explanation of what that’s all about. And it’s not at all clear what is accomplished thereby.
At the top are a bank’s assets. Below are its obligations to various parties, with decreasing seniority from left to right. I’ve drawn it to embody a pessimistic assumption about the bank’s finances, because those are the cases we’re interested in: the bank’s assets aren’t enough to cover its debts. Nonetheless, the stock, both preferred and common, has a positive market value. Why? Because of the Geithner put: the bank is protected from collapse, keeping the creditors appeased, but stockholders will get the gains if somehow things turn up.
What we want to do is clean up the bank’s balance sheet, so that it no longer has to be a ward of the state. When the FDIC confronts a bank like this, it seizes the thing, cleans out the stockholders, pays off some of the debt, and reprivatizes.
What Treasury now seems to be proposing is converting some of the green equity to blue equity — converting preferred to common. It’s true that preferred stock has some debt-like qualities — there are required dividend payments, etc.. But does anyone think that the reason banks are crippled is that they are tied down by their obligations to preferred stockholders, as opposed to having too much plain vanilla debt?
I just don’t get it. And my sinking feeling that the administration plan is to rearrange the deck chairs and hope the iceberg melts just keeps getting stronger.
Welcome to my world Mr. Krugman!
Everything being done right now is all about buying time. And more time. The central belief is still that many of these dud debts are going to miraculously become good in the future. This flies in the face of everything we know. Is there something else? Something myself and even Mr. Krugman are missing?
The only thing I think can explain the "buy time" mantra is that the FED/Treasury know they are going to monetize this debt and devalue the dollar. Obviously this is going to take, what class?, that's right, TIME. The dollar having a huge rally lately only makes the need for TIME that much more pressing. The FED will want to gently devalue the dollar in small increments as to avert a panic. This will take TIME. When viewed through this lens, I think we may be closer to the answer.
If it comes down to the FED being able to orchestrate and orderly devaluation, I think they may be overconfident. Time will tell.
Have a good night.
Monday, February 23, 2009
Decision and Preparation Time
Nasty little rain/ice/snow storm last night. My car was encased in a shell of ice this morning. Tons of fun. I do so love the winter.
Decision Time
I imagine most readers are aware of the overall market collapse today. I will not rehash the final numbers nor extrapolate possible "support" areas. Technical analysis has its place in an overall understanding of things, but as I have said before it fails spectacularly at inflection points. The current market meltdown is singular in spirit to anything that has happened before (it's a whole new paradigm!) and thus little help can be gleamed from history.
The government was out in force today with the missive that there will be no nationalization of the banks. How one can pump over 50 Billion dollars into Citi and Bank of America when their combined market caps are less than 30 Billion and pretend that they are private operators is lost on me. And it is lost on the markets. AIG, never one to be shy, was back with hat in hand looking for more money. I am sure they are a "private entity" as well.
A helpful article that covers the total panic gripping the government can be read here. Key excerpt:
The whole article is worth your time.
So where are we? I suggest we have reached decision time. The core plan of the banks and the FED/Treasury has always been about buying time. The assumption was that all the credit issues needed time to turn a hypothetical corner, and all would be well. If one considers the collapse of Long Term Capital Management, this was indeed the case. While the giant hedge fund almost brought the whole show down in 1998, after they were bailed out, their positions ultimately were profitable (slightly). The thinking was that this episode would turn out the same if a reasonable time span could be "bought", say 8 months to a year.
Times up. The looming shoe to drop is the incredible amount of credit (ie debt) that was extended during the lending boom of 2002-2006 that is a total loss. While this in and of itself would not be cause for panic, all that debt was then levered up (maybe up to 100-1, who knows?) and exists as a trillions of dollars of "money" that exists nowhere but in the notional sense. This is the ultimate perversion that fiat currencies can fall into. How many trillions? Again, who can say. Back of the envelope estimates range from the low end of 50 trillion dollars to a high end of 300 trillion dollars. This is money that truly does not exist and has no collateral to back it up.
The decision that must be made is this: What is going to be done with this debt?
Trying to paper over it and buy time has failed. Total and epic failure. The adults must return to their senses and start laying the ground work for the dissolution of almost all of the mythical money that is out there.
One would think that because this money never really existed in the first place that it should be no problem to simply declare it null and void. As is often the case, it is not that simple. Now understand that I do not have all the answers, in fact I have very few. The convoluted system of leverage packed into derivatives, and insured with CDO's and other exotic debt instruments makes this task both daunting and possibly a non starter. My basic question is the only one that matters still. What is going to be done with all of the debt built on assets that may never recover their value? Until and unless this question is tackled by our government, and others around the world, things will continue to erode and fall apart.
Preparation Time
Another area that I am woefully under informed in is civics. Constitutional process and governmental process is not something I have much knowledge of. I need to get some. We all need to get some, fast.
We are fast approaching a moment when our government may stop doing anything to help it's own citizens and instead focus on placating foreign debt holders and/or giving whatever wealth the country has away to government staff. We need to know what, if anything can be done to stop such actions. You get no credit for suggestion using elections to remove politicians. First off the speed at which the fleecing of America can occur will happen well before any election can happen. Second, do you really think anyone is going to lose their seat? We had Charles Schumer saying, on camera, that the American people do not care about all the pork in the stimulus bill. That clown will still win reelection with over 80% of the vote in his state.
As a thought experiment, consider the following action by the Congress and what may be done to stop them:
-Taxes rates raised across the board to 70% of gross income
-10 Trillion Dollars allotted to both the Senate and the House to use as each member sees fit to help the economy
Such a raiding of the Treasury would have to be stopped. But how?
While the above is an extreme example, keep in mind that the TARP plans were opposed by a solid majority of voters (over 65%) and the bank bailouts and mortgage bailout plans run even higher opposition numbers. Will that slow them down? What would?
At this time we need to get prepared to defend ourselves against government actions that may represent THEIR best interests, but not OURS. By this I do not mean conflict or revolution. I mean there must be channels and a process to stop the government when it is clearly lost its way and is doing great damage to the country. A proverbial "STOP" button if you will.
If you have ideas, leave them in the comments section.
Some may think a day like today is something this blogger likes. I have been called a "doom and gloom" blog. I hate days like today. It scares the hell out of me to watch BAC go down over 90% in a few months while I have all my money parked there. This blog was never meant to be a "lets have the end of the world" kind of thing. I just wanted an end to the insanity of credit creation based upon stupid beliefs and granite counter tops.
If this could have only happened in 2003, 2004, or 2005 maybe there would be a way out of the woods that would not be so damaging. Unfortunately, the party went on right until the last minute possible. We are in no man's land, be careful!
Have a good night.
Decision Time
I imagine most readers are aware of the overall market collapse today. I will not rehash the final numbers nor extrapolate possible "support" areas. Technical analysis has its place in an overall understanding of things, but as I have said before it fails spectacularly at inflection points. The current market meltdown is singular in spirit to anything that has happened before (it's a whole new paradigm!) and thus little help can be gleamed from history.
The government was out in force today with the missive that there will be no nationalization of the banks. How one can pump over 50 Billion dollars into Citi and Bank of America when their combined market caps are less than 30 Billion and pretend that they are private operators is lost on me. And it is lost on the markets. AIG, never one to be shy, was back with hat in hand looking for more money. I am sure they are a "private entity" as well.
A helpful article that covers the total panic gripping the government can be read here. Key excerpt:
Folks, the government is operating in full panic mode.
If Bernanke stops printing, we're back in crash mode, if he continues printing at 20% rates, it's fierce inflation. Think about it, all the crooked adults are gone from the scene.The key Goldman Sachs players, Robert Rubin and Henry Paulson are gone. News came just yesterday that Goldman Sachs President and Co-Chief Operating Officer Jon Winkelried will retire effective March 31.
They are all crawling under rocks. They know what's coming. They have left as Treasury Secretary, a kid, who can't even get a press conference right. The president, even if given the benefit of the doubt that he is sincere, was brought up on socialist propaganda. He doesn't have a clue. The stimulus package is just the insiders raiding the till while there is still money in it.
The whole article is worth your time.
So where are we? I suggest we have reached decision time. The core plan of the banks and the FED/Treasury has always been about buying time. The assumption was that all the credit issues needed time to turn a hypothetical corner, and all would be well. If one considers the collapse of Long Term Capital Management, this was indeed the case. While the giant hedge fund almost brought the whole show down in 1998, after they were bailed out, their positions ultimately were profitable (slightly). The thinking was that this episode would turn out the same if a reasonable time span could be "bought", say 8 months to a year.
Times up. The looming shoe to drop is the incredible amount of credit (ie debt) that was extended during the lending boom of 2002-2006 that is a total loss. While this in and of itself would not be cause for panic, all that debt was then levered up (maybe up to 100-1, who knows?) and exists as a trillions of dollars of "money" that exists nowhere but in the notional sense. This is the ultimate perversion that fiat currencies can fall into. How many trillions? Again, who can say. Back of the envelope estimates range from the low end of 50 trillion dollars to a high end of 300 trillion dollars. This is money that truly does not exist and has no collateral to back it up.
The decision that must be made is this: What is going to be done with this debt?
Trying to paper over it and buy time has failed. Total and epic failure. The adults must return to their senses and start laying the ground work for the dissolution of almost all of the mythical money that is out there.
One would think that because this money never really existed in the first place that it should be no problem to simply declare it null and void. As is often the case, it is not that simple. Now understand that I do not have all the answers, in fact I have very few. The convoluted system of leverage packed into derivatives, and insured with CDO's and other exotic debt instruments makes this task both daunting and possibly a non starter. My basic question is the only one that matters still. What is going to be done with all of the debt built on assets that may never recover their value? Until and unless this question is tackled by our government, and others around the world, things will continue to erode and fall apart.
Preparation Time
Another area that I am woefully under informed in is civics. Constitutional process and governmental process is not something I have much knowledge of. I need to get some. We all need to get some, fast.
We are fast approaching a moment when our government may stop doing anything to help it's own citizens and instead focus on placating foreign debt holders and/or giving whatever wealth the country has away to government staff. We need to know what, if anything can be done to stop such actions. You get no credit for suggestion using elections to remove politicians. First off the speed at which the fleecing of America can occur will happen well before any election can happen. Second, do you really think anyone is going to lose their seat? We had Charles Schumer saying, on camera, that the American people do not care about all the pork in the stimulus bill. That clown will still win reelection with over 80% of the vote in his state.
As a thought experiment, consider the following action by the Congress and what may be done to stop them:
-Taxes rates raised across the board to 70% of gross income
-10 Trillion Dollars allotted to both the Senate and the House to use as each member sees fit to help the economy
Such a raiding of the Treasury would have to be stopped. But how?
While the above is an extreme example, keep in mind that the TARP plans were opposed by a solid majority of voters (over 65%) and the bank bailouts and mortgage bailout plans run even higher opposition numbers. Will that slow them down? What would?
At this time we need to get prepared to defend ourselves against government actions that may represent THEIR best interests, but not OURS. By this I do not mean conflict or revolution. I mean there must be channels and a process to stop the government when it is clearly lost its way and is doing great damage to the country. A proverbial "STOP" button if you will.
If you have ideas, leave them in the comments section.
Some may think a day like today is something this blogger likes. I have been called a "doom and gloom" blog. I hate days like today. It scares the hell out of me to watch BAC go down over 90% in a few months while I have all my money parked there. This blog was never meant to be a "lets have the end of the world" kind of thing. I just wanted an end to the insanity of credit creation based upon stupid beliefs and granite counter tops.
If this could have only happened in 2003, 2004, or 2005 maybe there would be a way out of the woods that would not be so damaging. Unfortunately, the party went on right until the last minute possible. We are in no man's land, be careful!
Have a good night.
Sunday, February 22, 2009
Sunday Radar
While I am waiting for the race in Fontana California to start, I wanted to throw a few things that are on worthy of attention. This entire weekend is knee deep with information, so good luck trying to read it all!
Mortgage Bailout for Asian Investors
Last Wednesday I posted that the really big part of the new mortgage plan was not the silly applications to actual homeowners, but the gigantic expansion of support for Fannie/Freddie. The Chinese have made a bunch of noise on this issue, and they obviously wanted something done.
This weekend there are plenty of stories covering the nasty interplay of Asian investors and our expectation that they buy up all the debt we are going to issue.
Clinton: China Must Continue to Invest in U.S. BondsSecretary of State Tells Chinese 'We Are Truly Going to Rise or Fall Together'
Article covers our need for the money to keep rolling in.
Foreigners Wary of Long-Term U.S. Securities
Seems like appetite is waning?
Maybe, Possibly Some Details on the Bank Plan
This CNBC article says that we might get some details on the stress tests for the banks. Amazingly, there may even be results by Wednesday!!?? Does that stick out to you as a bit fishy? We know the big banks are insolvent, yet it appears that they will get a "seal of approval" after a fake stress test. This is quickly setting up to be the biggest scam we have seen so far. I fully expect bank stocks to go bonkers to the upside as they get a gold star form a fixed process. When is this crap going to stop?
I guess it makes perfect sense. Unable to do anything constructive because the banking system is so broken, the new plan will be to just call is "All Good" and keep pretending. Sadly I think the markets will love this charade. Bank of America and Citigroup could triple in price this week on this fraud. Keep an eye on this one.
Have a good night.
Mortgage Bailout for Asian Investors
Last Wednesday I posted that the really big part of the new mortgage plan was not the silly applications to actual homeowners, but the gigantic expansion of support for Fannie/Freddie. The Chinese have made a bunch of noise on this issue, and they obviously wanted something done.
This weekend there are plenty of stories covering the nasty interplay of Asian investors and our expectation that they buy up all the debt we are going to issue.
Clinton: China Must Continue to Invest in U.S. BondsSecretary of State Tells Chinese 'We Are Truly Going to Rise or Fall Together'
Article covers our need for the money to keep rolling in.
Foreigners Wary of Long-Term U.S. Securities
Seems like appetite is waning?
Maybe, Possibly Some Details on the Bank Plan
This CNBC article says that we might get some details on the stress tests for the banks. Amazingly, there may even be results by Wednesday!!?? Does that stick out to you as a bit fishy? We know the big banks are insolvent, yet it appears that they will get a "seal of approval" after a fake stress test. This is quickly setting up to be the biggest scam we have seen so far. I fully expect bank stocks to go bonkers to the upside as they get a gold star form a fixed process. When is this crap going to stop?
I guess it makes perfect sense. Unable to do anything constructive because the banking system is so broken, the new plan will be to just call is "All Good" and keep pretending. Sadly I think the markets will love this charade. Bank of America and Citigroup could triple in price this week on this fraud. Keep an eye on this one.
Have a good night.
Labels:
Asian Investor bailout,
Stress Test Fraud
Friday, February 20, 2009
Friday Night Blowoff Top
That was some week! But I guess every week going back to last August has been pretty interesting. I get a bit lost in the sea of information that is available, so feel free to leave articles and comments of things you think are important.
Some Good Housing News
Economic Disconnect gets a bad rap as a "doom and gloom" site. I would characterize this blog as informative and entertaining. If the information is rough, I cannot control that, it speaks for itself. That said I feel I should report some good news on the housing front as to give some balance to my slanted coverage.
It seems there are some silver linings and rays of light coming from the housing bust. Here is a wonderful human interest tale sure to warm your hearts:
See, I can report positive news as well. We need bumper stickers made up that say "Be Squatters in Your own Home!"
Chilling Articles
If you like horror movies or scary books I found two articles that might keep you up for two nights without sleep, which happens to me every single time I watch the film "The Exorcist". Advisory: After reading these articles I actually printed out a gun license application! Any readers have a suggestion on what kind of rifle and shotgun are most practical if you could only have 1 of each? I am not interested in handguns.
First up, a worldwide movement to make the dollar no longer the reserve currency of the world:
PUTIN: POST-US WORLD BLUEPRINT
Second, the terrible situation facing European banks:
The Looming Collapse of European Banking
You were warned!
Street Advice for the Treasury
What would hard men that live in brutal cities in gangs think of the current response to the banking crisis? Someone actually found out! Summary at end is pretty good:
Hard to argue with that!
Friday Night Blowoff Top
I find it hard to believe but it seems the White House, while ignoring any polls that show overwhelming opposition to bailouts and mortgage subsidies, found it necessary to comment on the now famous Rick Santelli rant shown here and everywhere on earth yesterday. From the Clusterstock article:
Excuse me, but all Mr. Santelli ranted about was that most people do not want to pay for other peoples mortgages. What's to know? Just who in the f#cking world does Press Secretary Gibbs think HE is to say anyone else has no idea what they are talking about? I mean Gibb's boss had his first primetime press conference on a Monday night a couple of weeks ago and said that his treasury secretary would "have his day in the sun" on Tuesday when he was to unveil the big bank rescue plan. During Monday night Geithner had second thoughts and scrapped the whole thing and then made a fool of himself, in the sun, on Tuesday. Rick Santelli does not know what he is talking about? The whole economic team of the administration doesn't either.
The market opened pretty bad and when no rally occurred before 12 noon I knew what was going to happen. There would be a rally late (after 2pm) to the close and all the talking heads would start the "double bottom" and "is this THE bottom" talk. Baloney. What happened was the markets were shelled big time and then everyone who was short closed positions before market close. Nobody wants to hold an open position over a weekend especially when you know the government is going to try something. There was your rally. Option expirations added to the volatility, but basically it was just flight from the market before the weekend. Your welcome.
Gold and Silver continued their grand performance. Love em both,
The Odyssey Marine Expedition show last night was another disappointment. Plenty of wrecked submarines, plenty of interesting historical tidbits, but no GOLD! I still own OMEX stock but these guys are not making it easy!
Barney Frank is working to legalize online poker. Once in my life I support Mr. Frank. The poker ban was snuck into the Port Security Bill from a few years back and banned US players from playing poker online. I stopped playing at that time. I do not know if I would play again, but it would be nice to have the option.
That is about everything that is running through my mind, well the sections not reserved for thinking about fishing and long romantic evenings alone with Danica Patrick that is! A speculative blowoff top of thought!
Friday Night Entertainment
With SO MANY suggestions in the comments section I may have a hard time fitting all of them in. NOT!
Bed and Breakfast
Ah, yes. The combination of a warm bed and then breakfast:

more animals
Because I Choose To
From last night's blog, here is the Agent Smith and Neo Exchange:
Rock Blogging
In honor of Rick Santelli I am posting the ultimate anger song from Drowning Pool called "Let the Bodies hit the Floor" as it should apply to the banks of course:
A song that is sad enough to even make Kevin upset, try out Garth Brooks and "What She's Doing Now". great song and it applies to our fading caplitalism, whats she doing now? (sorry for the stupid CSI video wiht the song, only clip available):
I heard the most terrible cover of the great song "Love Hurts" by Nazareth on the radio today. I have no idea who the band was that covered it, but they ruined it. Enjoy the original:
I have no idea in the whole wide world why I had the video for this song pop into my head today. Strange MTV flashbacks! Anyway, here is Joe Jackson with "Steppin' Out" and yes I know I have some serious issues!:
Have a good night.
Some Good Housing News
Economic Disconnect gets a bad rap as a "doom and gloom" site. I would characterize this blog as informative and entertaining. If the information is rough, I cannot control that, it speaks for itself. That said I feel I should report some good news on the housing front as to give some balance to my slanted coverage.
It seems there are some silver linings and rays of light coming from the housing bust. Here is a wonderful human interest tale sure to warm your hearts:
ECONOMY-US: Squatters See Silver Lining in Foreclosed Homes
By Matthew Cardinale
MIAMI, Florida, Feb 18 (IPS) - With foreclosures skyrocketing and U.S. families sinking deeper into poverty, a number of organisations are turning to a new strategy to end homelessness: moving families into vacant, foreclosed houses that are currently owned by banks or the government.
About 15 percent of the housing units in the United States in the fourth quarter 2008were vacant, representing 19 million units, according to a report from the U.S. Census Bureau. One advocacy group in Miami, Florida, Take Back the Land, has already moved seven families into foreclosed properties.
So far, city officials in Miami have declined to get involved, telling local newspapers that it is up to the property's owners - usually, the banks - to initiate any actions.
Four of the Miami families have already moved on to better situations, having been able to save up money during their months of squatting. Only once have police forced a family out of an abandoned property, but activists simply moved them to another one of thousands of vacant properties.
Meanwhile, one U.S. Congresswoman, Marcy Kaptur, an Ohio Democrat, is advising her constituents not to leave their homes if they are foreclosed on.
"So I say to the American people, be squatters in your own home! Don't you leave!" Kaptur said this month on the U.S. House floor.
See, I can report positive news as well. We need bumper stickers made up that say "Be Squatters in Your own Home!"
Chilling Articles
If you like horror movies or scary books I found two articles that might keep you up for two nights without sleep, which happens to me every single time I watch the film "The Exorcist". Advisory: After reading these articles I actually printed out a gun license application! Any readers have a suggestion on what kind of rifle and shotgun are most practical if you could only have 1 of each? I am not interested in handguns.
First up, a worldwide movement to make the dollar no longer the reserve currency of the world:
PUTIN: POST-US WORLD BLUEPRINT
Second, the terrible situation facing European banks:
The Looming Collapse of European Banking
You were warned!
Street Advice for the Treasury
What would hard men that live in brutal cities in gangs think of the current response to the banking crisis? Someone actually found out! Summary at end is pretty good:
"The unanimous opinion among The Thugz was that you must base your work around a time-tested law of ghetto capitalism: losers must die in full view. What? This doesn’t make sense. O.K., well, let me explain. Your first mistake (more accurately, your predecessor’s error) was to mix the bad apples (banks) with the good (banks). By doing so, you forgot what makes capitalism so much fun: winners win at the losers’ expense, and everyone gets to watch and laugh. Sort of like public hangings, except reported on the financial pages. Otherwise, why read The Wall Street Journal?
The moral is: don’t ever take the joy of death away from the public. Because if you don’t see losers in pain, you begin to think the game is rigged. And we all know the game is fair, open, and transparent … yes?"
Hard to argue with that!
Friday Night Blowoff Top
I find it hard to believe but it seems the White House, while ignoring any polls that show overwhelming opposition to bailouts and mortgage subsidies, found it necessary to comment on the now famous Rick Santelli rant shown here and everywhere on earth yesterday. From the Clusterstock article:
White House Blasts Rick Santelli Over "The Rant"
Ok, we just changed our mind again. After getting tired of Santelli's rant, we're now back on his side after learning that the White House blasted him.
CBSNews: “I also think that it’s tremendously important that for people who rant on cable television – to be responsible and understand what it is they’re talking about. I feel assured that Mr. Santelli doesn’t know what he’s talking about,” Gibbs said during the daily White House briefing for reporters, CBS News’ Mark Knoller reports.
The White House press secretary did not stop there. Knoller reports that Gibbs went on to criticize the objectivity of cable news reporting.
“If I hadn’t worked on the campaign but simply watched the cable news scorekeeping of the campaign – we lost virtually every day of the race....” he said.
Dear Robert Gibbs: Shove it. Telling reporters when they're "being responsible" or when they're being "objective" isn't cool. This has shades of the Bush administration calling out the NYT for its aggressive reporting, which wasn't cool then.
Excuse me, but all Mr. Santelli ranted about was that most people do not want to pay for other peoples mortgages. What's to know? Just who in the f#cking world does Press Secretary Gibbs think HE is to say anyone else has no idea what they are talking about? I mean Gibb's boss had his first primetime press conference on a Monday night a couple of weeks ago and said that his treasury secretary would "have his day in the sun" on Tuesday when he was to unveil the big bank rescue plan. During Monday night Geithner had second thoughts and scrapped the whole thing and then made a fool of himself, in the sun, on Tuesday. Rick Santelli does not know what he is talking about? The whole economic team of the administration doesn't either.
The market opened pretty bad and when no rally occurred before 12 noon I knew what was going to happen. There would be a rally late (after 2pm) to the close and all the talking heads would start the "double bottom" and "is this THE bottom" talk. Baloney. What happened was the markets were shelled big time and then everyone who was short closed positions before market close. Nobody wants to hold an open position over a weekend especially when you know the government is going to try something. There was your rally. Option expirations added to the volatility, but basically it was just flight from the market before the weekend. Your welcome.
Gold and Silver continued their grand performance. Love em both,
The Odyssey Marine Expedition show last night was another disappointment. Plenty of wrecked submarines, plenty of interesting historical tidbits, but no GOLD! I still own OMEX stock but these guys are not making it easy!
Barney Frank is working to legalize online poker. Once in my life I support Mr. Frank. The poker ban was snuck into the Port Security Bill from a few years back and banned US players from playing poker online. I stopped playing at that time. I do not know if I would play again, but it would be nice to have the option.
That is about everything that is running through my mind, well the sections not reserved for thinking about fishing and long romantic evenings alone with Danica Patrick that is! A speculative blowoff top of thought!
Friday Night Entertainment
With SO MANY suggestions in the comments section I may have a hard time fitting all of them in. NOT!
Bed and Breakfast
Ah, yes. The combination of a warm bed and then breakfast:

more animals
Because I Choose To
From last night's blog, here is the Agent Smith and Neo Exchange:
Rock Blogging
In honor of Rick Santelli I am posting the ultimate anger song from Drowning Pool called "Let the Bodies hit the Floor" as it should apply to the banks of course:
A song that is sad enough to even make Kevin upset, try out Garth Brooks and "What She's Doing Now". great song and it applies to our fading caplitalism, whats she doing now? (sorry for the stupid CSI video wiht the song, only clip available):
I heard the most terrible cover of the great song "Love Hurts" by Nazareth on the radio today. I have no idea who the band was that covered it, but they ruined it. Enjoy the original:
I have no idea in the whole wide world why I had the video for this song pop into my head today. Strange MTV flashbacks! Anyway, here is Joe Jackson with "Steppin' Out" and yes I know I have some serious issues!:
Have a good night.
Thursday, February 19, 2009
Stop Threatening Me With Economic Terrorism
Tomorrow is Friday! After just a 4 day work week I still feel wiped out. Get your film, books, music requests in for Friday Night Entertainment, after this week of frustrating government manipulation it may be all that stands between you and insanity!
Current Book Read
I picked up the book "Illegal Tender" by David Tripp. The novel chronicles the saga of a 1933 double eagle gold coin that escaped the clutches of the gold takeaway by FDR. The final coin recently sold for over 7 Million dollars at auction. The coin traveled far and wide and tracking it down was a main priority of the Secret Service for years. Fun read so far, I am about half way through. The book has a wonderful chronicling of how gold was flying away from the US and the obscene powers assumed by the government in the face of "systemic risk". Sounds familiar?
Where Was Aluminum's' Bailout?
By now we are tired of hearing that home prices need to be supported, stock prices need to rebound, and that baseball cards are actually very undervalued. The mania to get asset prices up is running full throttle. Historically this was not always the case. Take the poor metal aluminum.
Aluminum is the most common earth metal, but due to its reactivity it is almost never found in the pure metal state. Aluminum exists as an ore, usually bauxite. Pure aluminum metal was once one of the most sought after and valuable metals on earth. Then disaster struck. two independent discovers, Charles Martin Hall and Paul Heroult found a way to purify aluminum from all the ores where it could be found! This made pure aluminum as common as wood. From the Legacy section on Wikipedia:
Now what do you think happened to all the aluminum jewelry makers? What about the shipping industry and mining for pure aluminum? Gone. Busted. This no doubt had a huge effect on asset prices across the board. Did the world end?
You know it did not silly, we are still here! The industry changed and moved on. That is it. That is all. By my highly scientific calculations I have figured that if the US government had wanted to prop up aluminum prices over all this time at the old price, it would cost exactly 15 penta-tetra-gigbyte-trillion dollars to have done it (yes I corrected for inflation!). Not even helicopter Bernanke has a ship that big! Sometimes things change.
Stop Threatening Me With Economic Terrorism
First off let's get Rick Santelli's rant up, which was pretty awesome:
Pretty good stuff.
You can see Mr. Santelli's frustration starting to show. The traders around him also were more than quick to join in. They are not alone.
I on two different occasions today wanted to scream at what I was hearing. First up was Robert Shiller and this Tech Ticker spot where he argues not that the mortgage bailout plan is unethical, a moral hazard, or bound to fail but that it is NOT BIG ENOUGH! He further plays the game of "we all need this to happen" with this reasoning:
And on the fairness point, Professor Shiller argues that the plan does, in fact, help renters and comfortable home-owners, too--because we're all in this together, and because the economy is everyone's problem.
The second was from an interview that ran while the NBC Nightly News was on and the Rick Santelli rant was actually shown! Mark Zandi, who this blog has a long history of not liking (see this post from March 8th 2008) had a spot he resorted to what I can only describe as economic terrorism and threats. His rebuttal to calls that mortgage deadbeats should get no help was that if that help does not come, YOU will get hurt. He said that if YOUR home drops in value you cannot access that "equity" any longer and thus will be worse off.
Well Mr. Zandi, if my home drops in value it will not affect me one iota because I do not use my home as an ATM. I could go on and on, but he main point remains thus:
Home mortgages and other credit loans need to be made good for one reason and one reason only: To save the big conglomerate banks. Those firms hold so much influence and so much sway that they are threatening the Congress and the American people with economic terrorism.
Should they go bust, along with CDO's, derivatives, etc maybe the world will end. Maybe it will not. Maybe if the government keeps all the bailout cash and uses it to use local banks with solid balance sheets and conservative operations as the primary lenders things will be better than fine. Or not.
The point is that I CHOOSE TO SAY NO. I may be wrong. I may want to kiss Mark Zandi' butt after an economic collapse. I might pray to a Ben Bernanke statue should Armageddon happen. I may regret my decision to oppose rewarding reckless and just pure retarded behavior. Maybe so, and I fully own up to that I may be so wrong as all get out.
I still choose to say no. I choose to, just like Neo. There is right and there is wrong. There is what is just and there is what is not. We can debate the fine points of various bailouts all night. Right now I am just sick and angry with being threatened and told that I must submit to whatever is done or else. Well, I would like to see the "else". I do not like being threatened. I do not accept using fear and veiled references to "tanks in the streets" if bailouts do not happen. They say I will be worse off if I do not support the mortgage bailout of the octuplet baby lady's moms home that is in pre-foreclosure and I say I will bear that burden with the honor that I did not save the home of yet another idiot.
I imagine that is what it boils down to. Bankers, politicians, and market players (in general) have no shame, no honor, no sense of accomplishment, and no shame. To keep the status quo so they live life high on the hog they need us to be afraid, very afraid, so we do not ask too many questions or demand that responsibility be upheld.
Well, I am not afraid. Are you?
Have a good night.
Current Book Read
I picked up the book "Illegal Tender" by David Tripp. The novel chronicles the saga of a 1933 double eagle gold coin that escaped the clutches of the gold takeaway by FDR. The final coin recently sold for over 7 Million dollars at auction. The coin traveled far and wide and tracking it down was a main priority of the Secret Service for years. Fun read so far, I am about half way through. The book has a wonderful chronicling of how gold was flying away from the US and the obscene powers assumed by the government in the face of "systemic risk". Sounds familiar?
Where Was Aluminum's' Bailout?
By now we are tired of hearing that home prices need to be supported, stock prices need to rebound, and that baseball cards are actually very undervalued. The mania to get asset prices up is running full throttle. Historically this was not always the case. Take the poor metal aluminum.
Aluminum is the most common earth metal, but due to its reactivity it is almost never found in the pure metal state. Aluminum exists as an ore, usually bauxite. Pure aluminum metal was once one of the most sought after and valuable metals on earth. Then disaster struck. two independent discovers, Charles Martin Hall and Paul Heroult found a way to purify aluminum from all the ores where it could be found! This made pure aluminum as common as wood. From the Legacy section on Wikipedia:
Although aluminium is one of the most commonly occurring elements on Earth, before the invention of the Hall-Héroult process, it was initially found to be exceedingly difficult to extract from its various ores. This made the little available pure aluminium which had been discovered (or refined at great expense) more valuable than gold. Bars of aluminium were exhibited alongside the French crown jewels at the Exposition Universelle of 1855, and Napoleon III was said to have reserved a set of aluminium dinner plates for his most honored guests. Additionally, the pyramidal top to the Washington Monument is made of pure aluminium. At the time of the monument's construction, aluminium was as expensive as silver. Over time, however, the price of the metal has dropped; the invention of the Hall-Héroult process caused the high price of aluminium to permanently collapse.
Now what do you think happened to all the aluminum jewelry makers? What about the shipping industry and mining for pure aluminum? Gone. Busted. This no doubt had a huge effect on asset prices across the board. Did the world end?
You know it did not silly, we are still here! The industry changed and moved on. That is it. That is all. By my highly scientific calculations I have figured that if the US government had wanted to prop up aluminum prices over all this time at the old price, it would cost exactly 15 penta-tetra-gigbyte-trillion dollars to have done it (yes I corrected for inflation!). Not even helicopter Bernanke has a ship that big! Sometimes things change.
Stop Threatening Me With Economic Terrorism
"Why, Mr. Anderson? Why, why, why? Why do you do it? Why, why get up? Why keep fighting? Do you believe you're fighting for something, for more than your survival? Can you tell me what it is, do you even know? Is it freedom, or truth, perhaps peace, could it be for love? Illusions, Mr. Anderson, vagaries of perception. Temporary constructs of a feeble human intellect trying desperately to justify an existence that is without any meaning or purpose! And all of them as artificial as the Matrix itself. Although only a human mind could invent something as insipid as love. You must be able to see it Mr. Anderson, you must know it by now. You can't win, it's pointless to keep fighting! Why, Mr. Anderson, why? Why do you persist?
"Because I choose to."
Agent Smith and Neo in their final confrontation in Matrix Revolutions.
First off let's get Rick Santelli's rant up, which was pretty awesome:
Pretty good stuff.
You can see Mr. Santelli's frustration starting to show. The traders around him also were more than quick to join in. They are not alone.
I on two different occasions today wanted to scream at what I was hearing. First up was Robert Shiller and this Tech Ticker spot where he argues not that the mortgage bailout plan is unethical, a moral hazard, or bound to fail but that it is NOT BIG ENOUGH! He further plays the game of "we all need this to happen" with this reasoning:
And on the fairness point, Professor Shiller argues that the plan does, in fact, help renters and comfortable home-owners, too--because we're all in this together, and because the economy is everyone's problem.
The second was from an interview that ran while the NBC Nightly News was on and the Rick Santelli rant was actually shown! Mark Zandi, who this blog has a long history of not liking (see this post from March 8th 2008) had a spot he resorted to what I can only describe as economic terrorism and threats. His rebuttal to calls that mortgage deadbeats should get no help was that if that help does not come, YOU will get hurt. He said that if YOUR home drops in value you cannot access that "equity" any longer and thus will be worse off.
Well Mr. Zandi, if my home drops in value it will not affect me one iota because I do not use my home as an ATM. I could go on and on, but he main point remains thus:
Home mortgages and other credit loans need to be made good for one reason and one reason only: To save the big conglomerate banks. Those firms hold so much influence and so much sway that they are threatening the Congress and the American people with economic terrorism.
Should they go bust, along with CDO's, derivatives, etc maybe the world will end. Maybe it will not. Maybe if the government keeps all the bailout cash and uses it to use local banks with solid balance sheets and conservative operations as the primary lenders things will be better than fine. Or not.
The point is that I CHOOSE TO SAY NO. I may be wrong. I may want to kiss Mark Zandi' butt after an economic collapse. I might pray to a Ben Bernanke statue should Armageddon happen. I may regret my decision to oppose rewarding reckless and just pure retarded behavior. Maybe so, and I fully own up to that I may be so wrong as all get out.
I still choose to say no. I choose to, just like Neo. There is right and there is wrong. There is what is just and there is what is not. We can debate the fine points of various bailouts all night. Right now I am just sick and angry with being threatened and told that I must submit to whatever is done or else. Well, I would like to see the "else". I do not like being threatened. I do not accept using fear and veiled references to "tanks in the streets" if bailouts do not happen. They say I will be worse off if I do not support the mortgage bailout of the octuplet baby lady's moms home that is in pre-foreclosure and I say I will bear that burden with the honor that I did not save the home of yet another idiot.
I imagine that is what it boils down to. Bankers, politicians, and market players (in general) have no shame, no honor, no sense of accomplishment, and no shame. To keep the status quo so they live life high on the hog they need us to be afraid, very afraid, so we do not ask too many questions or demand that responsibility be upheld.
Well, I am not afraid. Are you?
Have a good night.
Wednesday, February 18, 2009
Mortgage Subsidies for the Chinese
Saw a hilarious thing today. As I was driving home on the highway I was slowed considerably when I was stuck behind a 1964 Dodge Dart automobile going about 30 m.p.h while the driver was talking his head off on his cell phone! The whole irony of a guy driving an ancient car but totally immersed in his technology telephone caused my to laugh pretty loud. Awesome stuff.
Government Plan to Help 10 People to Cost 75 Billion Dollars
I was rearing to go today in preparation for the Government mortgage plan that was to surely reward the foolish and take from the sound. I had already formulated a few thoughts to write down. Then a funny thing happened. The mortgage plan was on its merits silly, out of touch, and utterly feckless. If this is the kind of plan we get when we do actually get details, I cannot wait to see the new bank rescue plan should Timmy G ever get around to it.
Thanks to the site Capitalist Preservation I was able to get breaking coverage even while at work (yes I have a real job!). I was chuckling in my cubicle as I started to look over the details, most especially the questions and answer page and example listings.
Let's start with the Q&A page here:
That is a whole lotta NO's and a very small price window to qualify under.
The next act in the comedy show was the "real world" examples to make it easier to see what is offered. Full page here (PDF file).
First up, family A:
Forget about the whole new LTV allowances, did you see that 20% down line! That is a pure laugher. If the government thinks there are going to be a lot of loans like this they are dreaming. If Family A really put down 20% they would not be on the verge of foreclosure anyway. Classic.
Now onto family B:
Another whopper straight out of fantasy land. 26% down! Dreaming once again.
Families A and B may exist out there, but they are not really the issue. How many non-conforming loans are out there? How many were repackaged to Fannie/Freddie? Imagine an easier and far more common scenario using family B's numbers:
That example is a generous one at that. There are so many others so much worse.
The final family C example from the government is the only one I really cannot figure out:
This seems like a "kick the can down the road" plan meant to hide reality a bit longer. Sort of a conforming exploding ARM if you will. Again, how many will even want this deal?
There is some more stuff about how the government and the lenders will work out the numbers, but it is complicated.
Consider how many loans were obtained using fraudulent information. Will the government make sure all documentation is done this time? I could go on, and on.
So what was the point if the plan is so weak? Two things come to mind:
1.) The government will be able to say "look, foreclosures are dropping! We rule!". Sadly the mainstream media will miss the fact that Fannie/Freddie and others have a foreclosure moratorium on since December. Now others major players are waiting until after March to proceed. Of course foreclosures are going to drop for a while, none are being initiated!.
2.) That 75 Billion is not going to be used, not enough people will qualify. Do not expect that money to sit tight though, there will be sweetheart deals aplenty (think Chris Dodd of Conn.) for the government cronies to get new mortgages.
So what about that other 200 Billion dollars, the real meat of the plan?
Mortgage Subsidies for the Chinese
Late last week I read an article that covered the Chinese finance minister calling for more explicit guarantees of agency mortgage debt, ie Fannie/Freddie debt. (sorry, I could not pin down the link!) And now the government extends those guarantees from 200 Billion to 400 Billion in an afternoon. Ask and you shall receive. Hat tip Housing Doom and these relevant articles:
Central Banks Continue Retreat From Agency Debt
Twice As Effective Twice As Sovereign Fannie-Freddie Backstop Swells
Hence all the "conforming loan" language reiterated about 100 times in the government releases. This is an obvious effort to placate foreign mortgage debt holders that the US had their backs, no matter what.
What could be causing this stir? Take a peek at this compilation of mortgage performance for non-agency loans! One line shows us that as of 1/31/2009:
Delinquent (30,60,90 days,REO&Foreclosure) = 24.13%
A full quarter of all loans are in some form of foreclosure proceedings. That is scary!
Granted those are non-agency, non-conforming loans but how much better are the number for those? Might you want a more explicit guarantee if you held a ton of that paper? Yup.
A long post, but the events of today need some serious study. There is more going on below the surface than we can see. Transparency has gone the way of the dinosaur for over 8 years and it seems it will stay extinct for some time to come. Please use the comments section to add to this discussion.
Have a good night.
Government Plan to Help 10 People to Cost 75 Billion Dollars
I was rearing to go today in preparation for the Government mortgage plan that was to surely reward the foolish and take from the sound. I had already formulated a few thoughts to write down. Then a funny thing happened. The mortgage plan was on its merits silly, out of touch, and utterly feckless. If this is the kind of plan we get when we do actually get details, I cannot wait to see the new bank rescue plan should Timmy G ever get around to it.
Thanks to the site Capitalist Preservation I was able to get breaking coverage even while at work (yes I have a real job!). I was chuckling in my cubicle as I started to look over the details, most especially the questions and answer page and example listings.
Let's start with the Q&A page here:
How do I know if I am eligible?
Complete eligibility details will be announced on March 4th when the program starts. The criteria for eligibility will include having sufficient income to make the new payment and an acceptable mortgage payment history. The program is limited to loans held or securitized by Fannie Mae or Freddie Mac.
I have both a first and a second mortgage. Do I still qualify to refinance under the Homeowner Affordability and Stability Plan?
As long as the amount due on the first mortgage is less than 105% of the value of the property, borrowers with more than one mortgage may be eligible to refinance under the Homeowner Affordability and Stability Plan. Your eligibility will depend, in part, on agreement by the lender that has your second mortgage to remain in a second position, and on your ability to meet the new payment terms on the first mortgage.
Will refinancing reduce the amount that I owe on my loan?
No. The objective of the Homeowner Affordability and Stability Plan is to help borrowers refinance into safer, more affordable fixed rate loans. Refinancing will not reduce the amount you owe to the first mortgage holder or any other debt you owe. However, by reducing the interest rate, refinancing should save you money by reducing the amount of interest that you repay over the life of the loan.
Is my lender required to modify my loan?
No. Mortgage lenders participate in the program on a voluntary basis and loans are evaluated for modification on a case-by-case basis. But the government is offering substantial incentives and it is expected that most major lenders will participate.
I owe more than my property is worth, do I still qualify to refinance under the Homeowner Affordability and Stability Plan?
Eligible loans will now include those where the new first mortgage (including any refinancing costs) will not exceed 105% of the current market value of the property. For example, if your property is worth $200,000 but you owe $210,000 or less you may qualify. The current value of your property will be determined after you apply to refinance.
That is a whole lotta NO's and a very small price window to qualify under.
The next act in the comedy show was the "real world" examples to make it easier to see what is offered. Full page here (PDF file).
First up, family A:
In 2006: Family A took a 30-year fixed rate mortgage of $207,000 on a house worth $260,000 at the time. (The family put just over 20% down.) They received a Fannie Mae conforming loan with an interest rate of 6.50%.
Today: Family A has about $200,000 remaining on their mortgage but their home value has fallen 15 percent to $221,000.
Their “loan-to-value” ratio is now 90%, making them ineligible for a Fannie Mae refinancing.
Under the Refinancing Plan: Family A can refinance to a rate of 5.16%. This would reduce their annual payments by nearly $2,350.
Forget about the whole new LTV allowances, did you see that 20% down line! That is a pure laugher. If the government thinks there are going to be a lot of loans like this they are dreaming. If Family A really put down 20% they would not be on the verge of foreclosure anyway. Classic.
Now onto family B:
In 2006: Family B took a 30-year fixed rate mortgage of $350,000 on a house worth $475,000 at the time. (The family put just over 26% down.) They received a Fannie Mae conforming loan with an interest rate of 6.50%.
Today: Family B has about $337,460 remaining on their mortgage but their home value has fallen to $400,000.
Their “loan-to-value” ratio is now 84%, making them ineligible for a Fannie Mae refinancing.
Under the Refinancing Plan: Family B can refinance to a rate of 5.16%. This would reduce their annual payments by nearly $4,000.
Another whopper straight out of fantasy land. 26% down! Dreaming once again.
Families A and B may exist out there, but they are not really the issue. How many non-conforming loans are out there? How many were repackaged to Fannie/Freddie? Imagine an easier and far more common scenario using family B's numbers:
In 2006: Family B took an interest only mortgage of $475,000 on a house worth $475,000 at the time. (The family put nothing down.) They received a non-conforming loan with an interest rate of 6.50%.
Today: Family B has about $475,000 remaining on their mortgage but their home value has fallen to $400,000.
Their “loan-to-value” ratio is now 118%, making them ineligible for a Fannie Mae refinancing, or any other anywhere, anytime.
That example is a generous one at that. There are so many others so much worse.
The final family C example from the government is the only one I really cannot figure out:
In 2006: Family C took out a 30-year subprime mortgage of $220,000, on a house worth $230,000 at the time (they put less than 5% down). Their mortgage broker – Mom & Pop Mortgage – sold their loan to Investment Bank. The interest rate on their mortgage is 7.5%.
Today: Family C has $214,016 remaining on their mortgage but their home value has fallen -18% to $189,000. Also, in November, one parent in Family C was moved from full-time to part-time work, causing a significant negative shock to their income.
Their loan is now 113% the value of their home, making them “underwater” and unable to sell their house.
Meanwhile, their monthly mortgage payment is $1,538 and their monthly income has fallen to $3,650, meaning the ratio of their monthly mortgage debt to income is 42%.
Under the Homeowner Stability Initiative: Family C can get a government sponsored modification that – for five years – will reduce their mortgage payment by $406 a month. After those five years, Family C’s mortgage payment will adjust upward at a moderate, phased-in level.
This seems like a "kick the can down the road" plan meant to hide reality a bit longer. Sort of a conforming exploding ARM if you will. Again, how many will even want this deal?
There is some more stuff about how the government and the lenders will work out the numbers, but it is complicated.
Consider how many loans were obtained using fraudulent information. Will the government make sure all documentation is done this time? I could go on, and on.
So what was the point if the plan is so weak? Two things come to mind:
1.) The government will be able to say "look, foreclosures are dropping! We rule!". Sadly the mainstream media will miss the fact that Fannie/Freddie and others have a foreclosure moratorium on since December. Now others major players are waiting until after March to proceed. Of course foreclosures are going to drop for a while, none are being initiated!.
2.) That 75 Billion is not going to be used, not enough people will qualify. Do not expect that money to sit tight though, there will be sweetheart deals aplenty (think Chris Dodd of Conn.) for the government cronies to get new mortgages.
So what about that other 200 Billion dollars, the real meat of the plan?
Mortgage Subsidies for the Chinese
Late last week I read an article that covered the Chinese finance minister calling for more explicit guarantees of agency mortgage debt, ie Fannie/Freddie debt. (sorry, I could not pin down the link!) And now the government extends those guarantees from 200 Billion to 400 Billion in an afternoon. Ask and you shall receive. Hat tip Housing Doom and these relevant articles:
Central Banks Continue Retreat From Agency Debt
Twice As Effective Twice As Sovereign Fannie-Freddie Backstop Swells
Hence all the "conforming loan" language reiterated about 100 times in the government releases. This is an obvious effort to placate foreign mortgage debt holders that the US had their backs, no matter what.
What could be causing this stir? Take a peek at this compilation of mortgage performance for non-agency loans! One line shows us that as of 1/31/2009:
Delinquent (30,60,90 days,REO&Foreclosure) = 24.13%
A full quarter of all loans are in some form of foreclosure proceedings. That is scary!
Granted those are non-agency, non-conforming loans but how much better are the number for those? Might you want a more explicit guarantee if you held a ton of that paper? Yup.
A long post, but the events of today need some serious study. There is more going on below the surface than we can see. Transparency has gone the way of the dinosaur for over 8 years and it seems it will stay extinct for some time to come. Please use the comments section to add to this discussion.
Have a good night.
Tuesday, February 17, 2009
Apologies to Keynesian Clowns the World Over
When Tuesday become a Monday due to a holiday I always get all messed up. You would think that after all these years of the same occurrence I would figure it out. Maybe I should run for Congress, I seem to be qualified.
Stimulus On Demand
It seems that it is not too late for you to capture the American Dream and get your own stimulus check. All you have to do is fill out this form and a rider will be attached to legislation that will allocate your money request. Provided by Reason Magazine.
Here is what I filled out:
Request Your Stimulus
As the government gets set to spend over $800 billion to stimulate the economy, make sure to get your fair share of the plunder by participating in Reason's Personal Stimulus Generator. It only takes a minute and will be worth billions!
Add your request to the ledger below to get in on the action.
Recipient's Name: GetYourselfConnected
Amount of Desired Funding: $10,000,000 (that's 10 Million)
(please, no more than $350,000,000,000)
Purpose of Funding: To use fiat currency to buy gold and silver
(e.g., "avoid economic catastrophe" or "build bongs from recycled plastics")
Recipient's favorite sports team, living musical performer, or current live TV show: New England Patriots
Recipient's least favorite member of Congress: Barney Frank
Oh boy, I hope this thing is for real!
Technical Difficulties
There was a span last night and into this morning where I could not see my blog content, just the headers and sidebars. Weird. It seems to have been resolved now.
That was just a small tech glitch, but let us take a look at another technical difficulty that may prove problematic for the banks going forward. From AP via Yahoo Finance:
Classic. Seems fitting that the mortgage that was given due to a home value that never really existed may not exist in and of itself! If a mortgage note falls in the bank vault and nobody hears it, does it make a sound?
Seriously, this kind of technicality shows just how wild west mortgage origination became during the boom. While the story notes that some electronic version can be used a back-up, some judges may hold a hard line and demand the physical paperwork. Yet another wrinkle on the housing bust.
The rest of the article is worth a look as well. There are some revealing comments that should make one think long and hard about doing anything at all to help "homeowners" that are facing foreclosure. It appears that "gaming the system" made popular in mortgage fraud by buyers looking to buy way over their heads is alive and well and now is made up of delaying tactics to wait for a bailout:
Do you think these "homeowners" are paying anything during the 10-12 months that the bank takes to generate the proper paperwork? There is another term that more readily describes these "homeowners" and it is "SQUATTERS".
Strange Market Day
I had seen Market Tickers warning last night about crazy currency swings. The word was that Ireland may default, even as soon as this week. The Russian Markets got closed due to lock limit losses (I did not know they had even reopened since the last closure!) and the futures looked ugly all around. It was a down day for any and all (EXCEPT GOLD AND SILVER!) but check out this one day chart of the DOW:

The market gapped down then absolutely flatlined the whole day. Seems a bit strange to me. Maybe some of the trader types like reader Lisa could shed some light. The whole thing smelled bad to me.
My personal conspiracy theory: There is a guaranteed market bottom provided by the FED/Treasury right at the November lows. Today everyone unloaded, and the US government had to buy everything. My 2 cents. Actually my 1 cent as the other one was taken by the government to buy BAC stock today.
Apologies to Keynesian Clowns the World Over
I have often taken sharp jabs at the Keynesian economists and their silly graphs and models that they believe to hold all the answers to all things. today I think I may have to offer an apology to Keynesians everywhere. I was wrong to think that you were all way off base with your thinking. I was wrong to call you guys clowns and charlatans. I was wrong to make fun of you and reject your ideas outright. I am sorry.
The reason for my new view on those clowns, I mean those thinkers? California and a revealing blog post by Mr. Paul Krugman. It seems I was wrong to accuse Keynesian's of having the wrong solutions to economic problems, all along they have the correct solutions but to the WRONG PROBLEMS.
Allow me to explain. Here is the relevant post:
I One can only assume that Krugman means with this line "with all reasonable responses blocked by a fanatical, irrational minority" that the republican minority in the California state senate blocking any attempts to raise taxes.
Leaving aside any political debate, I see now how I misread Keynesians. For Mr. Krugman the problem with California is not huge budget shortfalls caused by government overspending and falling tax revenues due to a recession, the problem is that California cannot take well over 60% of the taxpayers income to bridge the "output gap". To a Keynesian the only issue is greasing the wheels with money, they never pay attention to all the sand in the wheel bearings eating up the metal.
Another example is home prices. The problem with falling home prices to a Keynesian is that mortgage credit is not available. Simply hand out money and support home prices and PRESTO! Crisis averted. They pay no mind to the question "Are home prices unsustainable? Are they too unaffordable? Should they fall to historical levels?". Again, those questions are beyond a Keynesian to ponder. They merely want to treat the symptoms of a disease, but they ignore the CAUSE.
Armed with this new found insight, I do apologize to the Keynesian thinkers. Where I thought you were both foolish and wrong, I see now that looking through the tiny window you call your "worldview" only allows you to focus on simple things.
It all makes sense. We are in the bust phase of the biggest credit bubble the world has ever seen. So many assets are still overvalued. So many homes still overpriced. So much US national debt that it can never be paid back. But instead of asking whether the 2005 high point in the credit boom was based on fundamentals or sustainable in any way, Keynesian's just trot out plans to get the government to spend whatever it has to to return the economy to bubble heights. That is no solution.
One of the reasons no progress has been made over the past year is that the wrong problems are being fought. Until and unless we can agree on and map out the actual structural issues no progress will be made. Time is running out.
Have a good night.
Stimulus On Demand
It seems that it is not too late for you to capture the American Dream and get your own stimulus check. All you have to do is fill out this form and a rider will be attached to legislation that will allocate your money request. Provided by Reason Magazine.
Here is what I filled out:
Request Your Stimulus
As the government gets set to spend over $800 billion to stimulate the economy, make sure to get your fair share of the plunder by participating in Reason's Personal Stimulus Generator. It only takes a minute and will be worth billions!
Add your request to the ledger below to get in on the action.
Recipient's Name: GetYourselfConnected
Amount of Desired Funding: $10,000,000 (that's 10 Million)
(please, no more than $350,000,000,000)
Purpose of Funding: To use fiat currency to buy gold and silver
(e.g., "avoid economic catastrophe" or "build bongs from recycled plastics")
Recipient's favorite sports team, living musical performer, or current live TV show: New England Patriots
Recipient's least favorite member of Congress: Barney Frank
Oh boy, I hope this thing is for real!
Technical Difficulties
There was a span last night and into this morning where I could not see my blog content, just the headers and sidebars. Weird. It seems to have been resolved now.
That was just a small tech glitch, but let us take a look at another technical difficulty that may prove problematic for the banks going forward. From AP via Yahoo Finance:
Homeowners' rallying cry: Produce the note
ZEPHYRHILLS, Fla. (AP) -- Kathy Lovelace lost her job and was about to lose her house, too. But then she made a seemingly simple request of the bank: Show me the original mortgage paperwork.
And just like that, the foreclosure proceedings came to a standstill.
Lovelace and other homeowners around the country are managing to stave off foreclosure by employing a strategy that goes to the heart of the whole nationwide mess.
During the real estate frenzy of the past decade, mortgages were sold and resold, bundled into securities and peddled to investors. In many cases, the original note signed by the homeowner was lost, stored away in a distant warehouse or destroyed.
Persuading a judge to compel production of hard-to-find or nonexistent documents can, at the very least, delay foreclosure, buying the homeowner some time and turning up the pressure on the lender to renegotiate the mortgage.
Classic. Seems fitting that the mortgage that was given due to a home value that never really existed may not exist in and of itself! If a mortgage note falls in the bank vault and nobody hears it, does it make a sound?
Seriously, this kind of technicality shows just how wild west mortgage origination became during the boom. While the story notes that some electronic version can be used a back-up, some judges may hold a hard line and demand the physical paperwork. Yet another wrinkle on the housing bust.
The rest of the article is worth a look as well. There are some revealing comments that should make one think long and hard about doing anything at all to help "homeowners" that are facing foreclosure. It appears that "gaming the system" made popular in mortgage fraud by buyers looking to buy way over their heads is alive and well and now is made up of delaying tactics to wait for a bailout:
"Chris Hoyer, a Tampa lawyer whose Consumer Warning Network Web site offers the free court documents Lovelace used to file her request, has played a major role in promoting the produce-the-note strategy.
We knew early on that the only relief that would ever come to people would be to the people who were in their houses," Hoyer said. "Nobody was going to fashion any relief for people who have already lost their houses. So your only hope was to hang on any way you could."
The first big success of the produce-the-note movement came in 2007 when a federal judge in Cleveland threw out 14 foreclosures by Deutsche Bank National Trust Co. because the bank failed to produce the original notes.
Michael Silver, a lawyer for two of the families in that case, said at least one eventually lost their home. Still, he considers that a success.
"From the perspective of the person who's in the home, you may have kept them in the house another 10 or 12 months," he said. "If I can get a result with economic benefits to a client, then I think I won."
Democratic Rep. Marcy Kaptur of Ohio endorsed the strategy in a fiery speech on the House floor during debate on the federal bank bailout last month.
"Don't leave your home," she said. "Because you know what? When those companies say they have your mortgage, unless you have a lawyer that can put his or her finger on that mortgage, you don't have that mortgage, and you are going to find they can't find the paper up there on Wall Street."
April Charney, head of foreclosure defense for Jacksonville Area Legal Aid in Florida, said the strategy has been so successful for her that she now travels around the country to train other lawyers in how to use it. She said she has gotten cases delayed for years by demanding that lenders produce paperwork they cannot find.
"This is an army of lawyers getting out there to stop foreclosures so we can get to the serious business of creating solutions," Charney said. "Nothing good is going to happen as long as we continue to bleed homeowners."
Do you think these "homeowners" are paying anything during the 10-12 months that the bank takes to generate the proper paperwork? There is another term that more readily describes these "homeowners" and it is "SQUATTERS".
Strange Market Day
I had seen Market Tickers warning last night about crazy currency swings. The word was that Ireland may default, even as soon as this week. The Russian Markets got closed due to lock limit losses (I did not know they had even reopened since the last closure!) and the futures looked ugly all around. It was a down day for any and all (EXCEPT GOLD AND SILVER!) but check out this one day chart of the DOW:

The market gapped down then absolutely flatlined the whole day. Seems a bit strange to me. Maybe some of the trader types like reader Lisa could shed some light. The whole thing smelled bad to me.
My personal conspiracy theory: There is a guaranteed market bottom provided by the FED/Treasury right at the November lows. Today everyone unloaded, and the US government had to buy everything. My 2 cents. Actually my 1 cent as the other one was taken by the government to buy BAC stock today.
Apologies to Keynesian Clowns the World Over
I have often taken sharp jabs at the Keynesian economists and their silly graphs and models that they believe to hold all the answers to all things. today I think I may have to offer an apology to Keynesians everywhere. I was wrong to think that you were all way off base with your thinking. I was wrong to call you guys clowns and charlatans. I was wrong to make fun of you and reject your ideas outright. I am sorry.
The reason for my new view on those clowns, I mean those thinkers? California and a revealing blog post by Mr. Paul Krugman. It seems I was wrong to accuse Keynesian's of having the wrong solutions to economic problems, all along they have the correct solutions but to the WRONG PROBLEMS.
Allow me to explain. Here is the relevant post:
Apocalypse now
Everyone should be paying attention to the political/fiscal catastrophe now unfolding in California. Years of neglect, followed by economic disaster — and with all reasonable responses blocked by a fanatical, irrational minority.
This could be America next.
I One can only assume that Krugman means with this line "with all reasonable responses blocked by a fanatical, irrational minority" that the republican minority in the California state senate blocking any attempts to raise taxes.
Leaving aside any political debate, I see now how I misread Keynesians. For Mr. Krugman the problem with California is not huge budget shortfalls caused by government overspending and falling tax revenues due to a recession, the problem is that California cannot take well over 60% of the taxpayers income to bridge the "output gap". To a Keynesian the only issue is greasing the wheels with money, they never pay attention to all the sand in the wheel bearings eating up the metal.
Another example is home prices. The problem with falling home prices to a Keynesian is that mortgage credit is not available. Simply hand out money and support home prices and PRESTO! Crisis averted. They pay no mind to the question "Are home prices unsustainable? Are they too unaffordable? Should they fall to historical levels?". Again, those questions are beyond a Keynesian to ponder. They merely want to treat the symptoms of a disease, but they ignore the CAUSE.
Armed with this new found insight, I do apologize to the Keynesian thinkers. Where I thought you were both foolish and wrong, I see now that looking through the tiny window you call your "worldview" only allows you to focus on simple things.
It all makes sense. We are in the bust phase of the biggest credit bubble the world has ever seen. So many assets are still overvalued. So many homes still overpriced. So much US national debt that it can never be paid back. But instead of asking whether the 2005 high point in the credit boom was based on fundamentals or sustainable in any way, Keynesian's just trot out plans to get the government to spend whatever it has to to return the economy to bubble heights. That is no solution.
One of the reasons no progress has been made over the past year is that the wrong problems are being fought. Until and unless we can agree on and map out the actual structural issues no progress will be made. Time is running out.
Have a good night.
Monday, February 16, 2009
Monday Market Vacation
Whole day off and I did basically nothing. Not one thing. If I could just get paid to do nothing everything would be so much easier.
Monday Market Vacation
Markets were closed today for the holiday. I spent a ton of time getting caught up on a bunch of reading. There seems to be a new level of desperation permeating the economic media. In no particular order, here is what caught my attention today.
Japan Q4 GDP shrinks 3.3 percent
Wow. I mean, scary wow! That rate makes an annual GDP shrinkage of almost 13%! Decoupling dies another slow death. That print number is about as unsettling as anything else I have read in over a year.
Break Up Big Banks, Says Community Banker
A brilliant and long overdo idea. The whole "too big to fail" excuse should be done with by making banks limited in size and scope. Instead of "too big to fail" the bad banks will be "bite sized for easy consumption". Key point from the article is thus:
GM, UAW in talks racing toward Tuesday deadline
I can say as a NASCAR fan the mood in the sport was nervous and scared during the Daytona 500 event week. Things do not look too good for the US automakers. I do not expect anything to be resolved this week, but certainly by the summer (think July) we will know if the Big 3 survive or not, and how much it will cost the taxpayer.
Kansas suspends income tax refunds, may miss payroll
Another state pulling the California screw job. How many more states are going to go for this? The FEDs can always print money to give you your tax refund, but will it be worth anything soon? These tax rebate suspensions are the very thing that could cause a real revolt.
BOOMERS – YOUR CRISIS HAS ARRIVED
Loyal reader Gawainsghost recommended this article, and it is provocative to say the least. Well worth the read. The generational descriptions are pretty good and the larger sociological implications are far reaching. I printed the article out as I want to spend more time digesting it. Reading it puts me in mind of another "Cycle" type idea, one I wrote about a while back that deals with "Simulacra and Simulation". Related material.
Bank Nationalization Gains Momentum
I saw at least 10 articles jumping on the nationalization bandwagon. This is not going to end well. A new name may take some of the sting away, and Calculated Risk is the early front runner with "Preprivatization".
Mike Morgan Clarifies What Exactly a Mortgage Bailout Means
Perfect article that captures what a mortgage bailout really means. Like I have written, the surest way to foment social acrimony is to have neighborhoods divided between the "bailout reduced mortgage" crowd and "the guys paying their full mortgage". The Mike Morgan site is excellent as a whole as well.
So that is what I did during my day off. Productive, huh?
It feels like we are coming down to "the moment" at last. I have had this feeling two other times over the past 6 months, so maybe I am off as usual. The slow realization that the banks are too far gone may be taking hold. Remember just last August when analyst's were optimistic after banks had "kitchen sink" write downs? Soon we should have a price tag presented as well. All told we should be on the hook for over 10 trillion dollars. What a country.
Have a good night.
Monday Market Vacation
Markets were closed today for the holiday. I spent a ton of time getting caught up on a bunch of reading. There seems to be a new level of desperation permeating the economic media. In no particular order, here is what caught my attention today.
Japan Q4 GDP shrinks 3.3 percent
Wow. I mean, scary wow! That rate makes an annual GDP shrinkage of almost 13%! Decoupling dies another slow death. That print number is about as unsettling as anything else I have read in over a year.
Break Up Big Banks, Says Community Banker
A brilliant and long overdo idea. The whole "too big to fail" excuse should be done with by making banks limited in size and scope. Instead of "too big to fail" the bad banks will be "bite sized for easy consumption". Key point from the article is thus:
"The money is going to sit on the sidelines until [regulators] announce they’re going to do something with these [big banks]. Nobody is going to put fresh capital into the banking business when your major competitor is going to be continuously bailed out by the United States government with more and more money.”
Rusty Cloutier, the president and CEO of MidSouth Bank
GM, UAW in talks racing toward Tuesday deadline
I can say as a NASCAR fan the mood in the sport was nervous and scared during the Daytona 500 event week. Things do not look too good for the US automakers. I do not expect anything to be resolved this week, but certainly by the summer (think July) we will know if the Big 3 survive or not, and how much it will cost the taxpayer.
Kansas suspends income tax refunds, may miss payroll
Another state pulling the California screw job. How many more states are going to go for this? The FEDs can always print money to give you your tax refund, but will it be worth anything soon? These tax rebate suspensions are the very thing that could cause a real revolt.
BOOMERS – YOUR CRISIS HAS ARRIVED
Loyal reader Gawainsghost recommended this article, and it is provocative to say the least. Well worth the read. The generational descriptions are pretty good and the larger sociological implications are far reaching. I printed the article out as I want to spend more time digesting it. Reading it puts me in mind of another "Cycle" type idea, one I wrote about a while back that deals with "Simulacra and Simulation". Related material.
Bank Nationalization Gains Momentum
I saw at least 10 articles jumping on the nationalization bandwagon. This is not going to end well. A new name may take some of the sting away, and Calculated Risk is the early front runner with "Preprivatization".
Mike Morgan Clarifies What Exactly a Mortgage Bailout Means
Perfect article that captures what a mortgage bailout really means. Like I have written, the surest way to foment social acrimony is to have neighborhoods divided between the "bailout reduced mortgage" crowd and "the guys paying their full mortgage". The Mike Morgan site is excellent as a whole as well.
So that is what I did during my day off. Productive, huh?
It feels like we are coming down to "the moment" at last. I have had this feeling two other times over the past 6 months, so maybe I am off as usual. The slow realization that the banks are too far gone may be taking hold. Remember just last August when analyst's were optimistic after banks had "kitchen sink" write downs? Soon we should have a price tag presented as well. All told we should be on the hook for over 10 trillion dollars. What a country.
Have a good night.
Subscribe to:
Posts (Atom)
