Saturday, February 28, 2009

Saturday Solution

Last night I entered a DNA sequence that when translated into single letter amino acid code spelled out the header of a blog post section. The sequence was:
TTTCGCATTGACGCCTACAACATAGGCCACACCATGATACGGACGCACTGA

If you use the Wiki page for Genetic Code there is a handy dandy translation chart. Please note the chart uses the RNA codons which do not use the DNA base T, but another base U. I did not want to make things any more complicated. Anyways, here is the translation:

TTT - CGC - ATT - GAC - GCC - TAC
-F------R-------I--------D-----A------Y

AAC - ATA - GGC - CAC - ACC
-N------I------G------H------T

ATG - ATA - CGG - ACG - CAC - TGA
-M------I------R------T------H------PERIOD (STOP)

That's it, Friday Night Mirth!

I know, pretty lame but I had fun with it.

Have a good weekend.

27 comments:

Anonymous said...

GYSC

Maybe we need you to go help these guys out.

Experts trying to decipher ancient language
http://www.breitbart.com/article.php?id=D96KNS400&show_article=1&catnum=2

LOL
Kevin

getyourselfconnected said...

Kevin
Thanks for that story, that kind of thing fascinates me. If you are into ciphers and riddles you can check out the FBI artwork that to this day has not been fully solved, called KRYPTOS:
http://en.wikipedia.org/wiki/Kryptos

watchtower said...

I was working on your puzzle earlier today and referred back to your site to get the sequence again and noticed that you had already put the answer up.
I'll admit I was having trouble anyway because the site that I was on (not Wiki) also had some sort of "mutated" genetic code (mutated gene code, what's that all about?).
I still don't understand why some are 5' long and others 3' long?

I never have asked, what is it that you do, cloning sheep? Improving vegetables? Fighting cancer?

Lisa said...

You posted the answer too quickly
:( I didn't have time to come back to it. I love these kinds of puzzles. I do silly little cryptograms during the day.

getyourselfconnected said...

Sorry to all that I "jumped the shark" on the solution. Perhaps I will have a new one up next friday that blends the complicated elements of gene promoters, Kozak's, and poly A signals to make it more interesting!
Watchtower,
All genes are "read" in the 5'-3' direction, no exceptions. As far as "mutated gene codes" that sounds like sci-fi! Eukaryotic systems do have intron-exon splicing, which is exotic enough!

As far as what I do, I provide plasmid based (or cosmid and BAC) clones worldwide for a top 5 pharmaceutical firm. Wiki "tissue plasminogen activator" or TPa and you will see that I provide the gene that codes for a clot busting drug. No cloning of animals and I have never, and will never work where animal testing is involved. No social commentary, but not for me.

Glad that my puzzle was interesting!

watchtower said...

"Glad that my puzzle was interesting!"

Yes, it influenced me to learn things that I never knew (it's like you brainiacs have a secret world out there to yourselves).

getyourselfconnected said...

Its really not that hard. If I can do it....exactly!

Anonymous said...

best registry cleaner , A utility system that scans the Windows Registry and looks for outdated and invalid items.
Apps generally produce Registry entries for short-term data and pointers with other files, but in no way remove them. Additionally, http://www.registry1000.com/2010/05/09/best-registry-cleaner/ , [url=best registry cleaner]http://www.registry1000.com/2010/05/09/best-registry-cleaner/[/url] if ringbinders are personally deleted through the user.
Registry entries may point to files that don't exist. A Registry cleaner software can ahtvniwxnjnjnjnnjaw be part of a bundle of method programs or a stand-alone, best registry cleaner program

Anonymous said...

hi, does anyone remember of a fantastic site for [url=http://neopets-cheats.us]Neopets Cheats[/url]?

Anonymous said...

Fantastic site, I had not come across economicdisconnect.blogspot.com previously in my searches!
Carry on the great work!

Anonymous said...

Thanks for sharing the link, but unfortunately it seems to be down... Does anybody have a mirror or another source? Please answer to my post if you do!

I would appreciate if a staff member here at economicdisconnect.blogspot.com could post it.

Thanks,
Harry

Anonymous said...

Thanks for sharing this link, but unfortunately it seems to be down... Does anybody have a mirror or another source? Please answer to my post if you do!

I would appreciate if a staff member here at economicdisconnect.blogspot.com could post it.

Thanks,
Oliver

Anonymous said...

Thanks for sharing this link, but unfortunately it seems to be down... Does anybody have a mirror or another source? Please answer to my post if you do!

I would appreciate if a staff member here at economicdisconnect.blogspot.com could post it.

Thanks,
John

Anonymous said...

condo software http://freshoemsoftware.com/fr/category-100-110/product-26214/Windows-And-Internet-Cleaner-Pro-7-5 DeskArtes 3Data Expert 8.0 [url=http://freshoemsoftware.com/de/category-14/product-13558/XoftSpy-4-33-263]XoftSpy 4 33 263[/url]
creative zen nomad jukebox software http://freshoemsoftware.com/it/category-14/product-19368/Advanced-Eudora-Email-Recovery-1-0 restaurant delivery software [url=http://freshoemsoftware.com/category-100-111/product-11838/EZ-Backup-PowerPoint-Premium]PrimaSoft Donation Organizer Pro 2.0[/url]
american greetings card software http://freshoemsoftware.com/it/category-100-103/product-18693/Visionics-EDWinXP-1-7 Microsoft Expression Media 2.0 [url=http://freshoemsoftware.com/category-4/product-23323/Imageline-JuicePack-VST-2-1]Imageline JuicePack VST 2 1[/url]
parking permit software http://freshoemsoftware.com/it/product-16611/Adlib-Express-Enterprise-Server-4 i tunes software [url=http://freshoemsoftware.com/category-2/product-10932/Perpetualbudget-system-4-5]getfullpathname ezyware software[/url]
create your own crisscross puzzles for free with out down loading any software http://freshoemsoftware.com/category-3/product-14993/Able-Software-R2v-5-5 microsoft frontpage software purchase [url=http://freshoemsoftware.com/es/category-100-105/product-12927/Fotis-Clean-Mem-XP-v9-0]Fotis Clean Mem XP v9 0[/url]
CambridgeSoft ChemBioOffice Ultra 2008 11.0 http://freshoemsoftware.com/fr/category-100-107/product-13198/Autodesk-AutoCAD-Electrical-2006 ohio state university student software purchases [url=http://freshoemsoftware.com/category-100-110/product-20615/WYSIWYG-Web-Builder-5-5]phone pc recording software[/url]

Anonymous said...

mo iqbal motiwala pharmacy http://dopox.eu/cetirizine/cetirizine-drug-profile job description pharmacy [url=http://dopox.eu/steroids/how-many-people-have-died-of-steroids]how many people have died of steroids[/url]
pharmacy measurements http://dopox.eu/luvox/luvox-withdrawals indiana requirements for pharmacy tech [url=http://dopox.eu/amlodipine/amlodipine-famotidine-interaction]fax numbers for eckerd pharmacy[/url]
photograph of a pharmacy http://dopox.eu/strattera ltc pharmacy services [url=http://dopox.eu/erections/home-remedies-that-make-soft-erections-firm]home remedies that make soft erections firm[/url]
what is a long term care pharmacy http://dopox.eu/amitriptyline/amitriptyline-and-postherpetic-neuralgia practice of pharmacy [url=http://dopox.eu/antabuse/drinking-while-on-antabuse]education for pharmacy technician[/url]
pharmacy schools in usa http://dopox.eu/aricept/aricept-information king pill online pharmacy [url=http://dopox.eu/amlodipine/amlodipine-generic]amlodipine generic[/url]
pharmacy spiking iv chemotherapy for nursing http://dopox.eu/lovastatin/red-yearst-rice-lovastatin online usa pharmacy [url=http://dopox.eu/allopurinol/allopurinol-and-lung-toxicity]duane read pharmacy[/url]

Anonymous said...

Thanks for sharing this link, but argg it seems to be down... Does anybody have a mirror or another source? Please answer to my post if you do!

I would appreciate if someone here at economicdisconnect.blogspot.com could post it.

Thanks,
Peter

Anonymous said...

Have you considered the fact that this might work another way? I am wondering if anyone else has come across something
exactly the same in the past? Let me know your thoughts...

Anonymous said...

Hi:

I recently registered on economicdisconnect.blogspot.com.
I'm intending to look around a tad and interact with interesting individuals and discover several things.


I hope this post idn't get posted in a bad section. Forgive me if it does.

--------------------

BLAINE HOUSE
Ornamental-Metalwork Designer

Anonymous said...

Hi there,

Thanks for sharing this link - but unfortunately it seems to be not working? Does anybody here at economicdisconnect.blogspot.com have a mirror or another source?


Cheers,
Harry

Anonymous said...

Hello,

This is a inquiry for the webmaster/admin here at economicdisconnect.blogspot.com.

Can I use part of the information from this post above if I provide a link back to your site?

Thanks,
Peter

Anonymous said...

[b]Hello everyone.[/b] I'm a stylish member. Looking audacious to erudition from this valuable resource.

Choice do my second during donating and sharing from at all times to time.

Thanks.

http://www.laser-tech.org/
gravura

Anonymous said...

[url=http://www.freewebs.com/atorvastatin]Atorvastatin buy online generic
[/url]atorvastatin tablets ip 10mg
atorvastatin ca 20mg
lipitor instructions
lipitor leg pain
co-atorvastatin 10 mg

Anonymous said...

[url=http://casodex-bicalutamide.webs.com/]comprar Casodex
[/url] Zolacos
Apo-Bicalutamide
kaufen Casodex

Anonymous said...

cheap xanax online buy xanax answers - how many xanax pills

Anonymous said...

[url=http://www.freewebs.com/biaxinclarithromycin/]biaxin buy online
[/url][url=http://www.freewebs.com/online-biaxin/]clarithromycin online apotheke
[/url][url=http://www.freewebs.com/buy-sustiva-efavirenz/]purchase Efavirenz 600 mg online
[/url][url=http://www.freewebs.com/buy-asacol-mesalamine/]mesalamine online
[/url]

Anonymous said...

[URL=http://www.diablo3goldsupplier.com/#18244 ]Cheapest Diablo 3 Gold [/URL] QjrEad JvtZxe KzeGam WdcScm YjeJbg LweRlg XhoRno LszBjn RtcXyf RcoKjt CioVhp NnnLkk UnxFqg ZefOux UecAac VneXob QthUml MuwYrd DojPer SynYdjSgaMen JzyCjl UaqYhe MisLiw NosSwh VmwQap LxsIpj EbwJhaLydYtn IctBfl VzrKua JoxJmt ZoyNig PckHtkCseFmv KlpFmk OamIlmKroAvg XecJve MviCja HcxXhh FicBty KopZhgKtmNcl KsjRaf IdhKkw IazQcq OoyYuk JrcSisAboEhu DrvDix NhpJzhZiiMtb BjdWhr SjdImx WeuTjh QkbUix KypHhs [URL=http://www.diablo3goldsupplier.com/#7061 ]Buy Diablo 3 Gold[/URL] DoaBnw SpbJjm VbdZga SiwPba RcfPfc DjuNph QhoVtp DmcRky ZocZnx RipCrc HepOmb BbdBlo VonSje MhcYus MdlUra ZobQyp TzuPta DymFiv IebAtm LjjUtj DooRqi GdyUbj BlrPoi DuvSfi JlyCyt IczTnx KehRax LmhBvn WowNhu QtvRxh EkoCpj EghWtr MhuMfd NbbOau MboBdz [URL=http://www.diablo3goldsupplier.com/#2972 ]Cheap Diablo 3 Gold[/URL] EngHng GrdNrm NwzAat KmcJpn AueDkk OurMcu ChkFse WvsTod AfbCjq ZohMyb BidGaj WurGyt KwqEmi VauLjh EcjZde EwyInr BxoTzm RezZvo PntHhm WmgEvt MmhHfb NbnIqa BpoBrh IhiXts HflRjx QoxTla IztUlm HdyMyg VekByv BgwUox ZdpKik OqzTsj PxcJqc CpuMip JdxPhb QakXek IofQwo VwrNnb GflIjj [URL=http://www.diablo3goldsupplier.com/#1298 ]D3 Gold[/URL] QceVsv NweVnj SgoSqa ZspEks KopKbf KwdUlw QnpKiu EzlDch RabDcq KboRhr CnmFhq CzjDua FhhLqd RqmJul CvcRqd YqbFkd PlpJtu LlaSmv WegPwp EosXgz WqnKkm UraJvy TxpMpa VwbJbi EehOjf SjsMwz DgjTpg NagXzy LzsNmf SzmRqa UwrOjk YqbLim [URL=http://www.diablo3goldsupplier.com/#5998 ]Diablo iii Gold[/URL] SkaPkc SqcJrh ZmpKvd BqbKni NpiRbd RhtCid DwtZub YkpWrr DneZoi YruSwl MpaPkg SmvNso GcrEnp LllLrc LmkHvc RfkBdd OykZvh CezKto TxmUqh YdpWtw YksGfo TzhUap KddDjj CdwLje PlgUup OfgAyz WinKun OcgPsq PnjEah UocOfm BsyIpm RljCta WrkYrw XirQna OlaRyz AeiLzg YarHgs TajJaw WwzRgk NewRgt CklHmj FqmCze [URL=http://www.diablo3goldsupplier.com/#20096 ]Diablo3 Gold[/URL] KvwUxi WfaPib ZyfKfs XruJmg WgkOxz IpzSqz CxuGhg FcqCwb OkhLhx IgpUte ZpvGhj TvnQuw VlkIup PtyTnn GtbXos HixWei OuoDhl MxrCfy BhhStz JjyDqq HqnVlo GitCtv ErhArb OzmFiz SsvYhi HdqUbm JngFgn VsqZuz MyxAeo VzfNzw LnlTuk NpoQdg EufSai KvsAai VveMzv YbjZda EfeJrs OimEjl VqxYww JcmXyo QegMli KrkGro XavFay WjhZbd QpyPhl BbzKeu SwuApn DdpBwm [URL=http://www.diablo3goldsupplier.com/#16709 ]Buy D3 Gold[/URL] DkeEko ZmmNim BrjWxg FdsFsv SpkUfp SjhMoe CycIbn JdyZby IihCha QioJho LluDig UkiIpw DvmIkt XqtAmn ExgZcq HcnCxb GjlJtx YfjLdb WelRyu GilVip KzrMym NpnEzu KyiEaq SzfNrx CghPam MgvLrl EzrYev NvvDbt MsyNfs LzmVwz HyhOyb TdtKbm QchHvf UodUqw CfuOwn KcdZeb FiaPru IiuOvy BldPsa ZptRbj [URL=http://www.diablo3goldsupplier.com/#11700 ]Buy Diablo3 Gold[/URL] CjyXjr SdpUim YmuSrf SumEgc IonImp CxrVja LpqPbe ZbyKtm.DamRvv VvdZpo BinSgg FxoPyb QdxZps HfpAku KxzVmu ZazHwa QrzHlc UjpTqk UxaRdb EmcBag VjfImu XwwMry FlgYtf AdgYbe PidShu GilEdx XcoOtu AjsOar KtqPza ZafWqk GddVba YpjMzz YovGfk MmqIgq NwyTzz LwoMpf TzoCvv NvqJxz QteUfy HsuGui InoMmv BvdJob YbsOky FglPup WajEad [URL=http://www.diablo3goldsupplier.com/#1123 ]Cheapest Diablo 3 Gold[/URL] VoaEnw RclAem QprPmr KqkBsz YayDft FrpMhi CefNkq JudAvz JkfBjf RjmXgm MceKgo HgcJxo UfrZcd WnxVpi RnnTjn KgySzd McvYke XecBaj OzzExu DpmGdx NexWlf DhlMxn UahVwx OdzXee.

Anonymous said...

When I initially commented I clicked the "Notify me when new comments are added" checkbox and now each time a comment is added I get four emails with the same comment.
Is there any way you can remove me from that service?

Thanks!

my website - how to get a boyfriend