The market rallied huge this morning, but I could not even see the volume bar for the SPY in Finviz. Sure enough a huge fade late in day made the whole thing suspect. It's still not a market you do anything but day trade, or maybe find high value stocks to buy and hold for a long time. As such, I don't have much to offer tonight on markets. Let's see if this will interest you.
The Song that Changed My Life
This post is inspired by a Twitter question as well as Dinosaurtrader's awesome post about the 20 year anniversary of Nirvana's Nevermind album.
I have always been a bit different than most people I grew up with. Most of the time it did not matter too much, but sometimes it did. Most of my friends were playing football and baseball, or joining gangs and getting in trouble around grade 5 in 1987. I don't like all the pads in football, I hate baseball, and Lowell was not a kind place for idiots back then. I don't know exactly how things may have turned out if not for watching Mtv one day when I was 11. Who can know such things?
Here is a list of the top 100 songs of 1987. You can see Bon Jovi, Posion, and other glam rock was well represented. I loved that stuff and I still do. But as I awaited the top 20 video countdown to come on (no YouTube!!) I was hoping Bon Jovi was still in the #1 spot. Ozzy Osbourne had just released his album "Tribute" which featured Randy Rhoads on lead guitar before his death. All I thought I knew about Ozzy at the time was that he worshipped the devil or something. Pass. Until the song opened up:
And I was stunned. I listened to the whole thing in silence and awe. I had never heard anything so powerful and raw. I couldn't move, I knew this was always going to be my favorite song and that I was meant to have found it.
I dashed out of the house when it was done and rode my bike 4 miles downtown to the tape store (yes a tape store) to get a copy. I listened to it until it broke. I am serious, it got overheated and broke. I was pissed, tapes were not cheap.
So how did this change my life other than expose me to heavy metal? Because everyone I knew hated the music and thought it was stupid. They all cracked on me to no end. This may sound silly, but when you are 11 what your "friends" think is huge. You could get left out by just the clothes you wear or the music you listened to. I didn't care. I knew this was my song, my music, my call.
And I have never worried about what other people think since. A couple years later I started riding my bike way across town to the West End Gym (the old one on Powell street) and started boxing, something I always wanted to do but my mother forbade it (It would be years until my mother found out). No one I knew would go with me, they all thought I was crazy. But I knew it was right for me. I knew what I wanted.
And on and on. To this day I still have 3 unopened CD copies of the Tribute album just in case I need them. There is one in the car as well. Ok, maybe that's a bit creepy. But I owe my independence to Ozzy and Randy, least I could do is buy a few albums.
Have a good night.
Showing posts with label Ozzy. Show all posts
Showing posts with label Ozzy. Show all posts
Tuesday, September 27, 2011
Saturday, October 9, 2010
Saturday Soreness
I must have raked up over 1000 pounds of acorns today! Just unreal. The yard looks great but my arms and back are not happy at this point. Getting old is no fun at all.
I bought two nice chuck roasts for tomorrow's BBQ. I will slow smoke them and make pulled beef at the end. I should post some pictures tomorrow.
No real huge games in the NFL and seeing that my picks have been atrocious I am lay off making them until after week 6 when I hope I have a better read on the teams. The only game this week that is big will be the Jets and Vikings. Randy Moss will have the cover of Adrian Petersons running so I will enjoy watching him vs. Darrelle Revis once again.
Ozzy Osbourne
Reader Watchtower asks why I have not played any of the newest Ozzy songs from the latest album. To be honest I have not been a huge fan of the later Ozzy albums. Ozzmosis was the last one I really liked. I don't think Ozzy has changed too much, but his music now just does not grab me like the older stuff. I like to think of this group of men who made some of the greatest music I have ever heard:

That is Randy Rhoads, Ozzy, Rudy Sarzo and Tommy Aldridge.
Don't Go to the Bathroom
For the boxing fans.
In 1989 there was a fight between Michael Nunn and Sumbu Kalambay. It was supposed to be the IBF/WBA unification bout, but the WBA stripped Kalambay before the fight. Kalambay was a rock solid boxer who had never been knocked out. Nunn was a boxer that could not punch his way out of a paper bag. Still, it looked to be a chess match kind of fight. The prefight stuff moved fast and I was in the bathroom when the opening bell rang. I figured no big deal, long fight. I heard the crowd going nuts and when I got out, the fight was all over:
What a shot! Maybe Nunn's only real KO victory.
One more. Iran Barkley shocks the world with an upset win over Thomas Hearns as Barkley was about to be knocked out himself (skip to the 6:00 mark):
I remember seeing that fight and being totally stunned.
And for an Ozzy at the very height of his powers and armed with the songwriting genius of Randy Rhoads, here is "Tonight" as a special bonus:
ADDED
Huge News
In what can only be described as history altering news, NASA's picture of the day clearly was photoshopped to hide an alien spacecraft near the Saturn moons of Titan and Dione:

The picture on the right clearly shows a space craft with some kind of ion drive. Maybe E.T's need a bailout and heard this was THE galaxy for that?
Have a good night.
I bought two nice chuck roasts for tomorrow's BBQ. I will slow smoke them and make pulled beef at the end. I should post some pictures tomorrow.
No real huge games in the NFL and seeing that my picks have been atrocious I am lay off making them until after week 6 when I hope I have a better read on the teams. The only game this week that is big will be the Jets and Vikings. Randy Moss will have the cover of Adrian Petersons running so I will enjoy watching him vs. Darrelle Revis once again.
Ozzy Osbourne
Reader Watchtower asks why I have not played any of the newest Ozzy songs from the latest album. To be honest I have not been a huge fan of the later Ozzy albums. Ozzmosis was the last one I really liked. I don't think Ozzy has changed too much, but his music now just does not grab me like the older stuff. I like to think of this group of men who made some of the greatest music I have ever heard:

That is Randy Rhoads, Ozzy, Rudy Sarzo and Tommy Aldridge.
Don't Go to the Bathroom
For the boxing fans.
In 1989 there was a fight between Michael Nunn and Sumbu Kalambay. It was supposed to be the IBF/WBA unification bout, but the WBA stripped Kalambay before the fight. Kalambay was a rock solid boxer who had never been knocked out. Nunn was a boxer that could not punch his way out of a paper bag. Still, it looked to be a chess match kind of fight. The prefight stuff moved fast and I was in the bathroom when the opening bell rang. I figured no big deal, long fight. I heard the crowd going nuts and when I got out, the fight was all over:
What a shot! Maybe Nunn's only real KO victory.
One more. Iran Barkley shocks the world with an upset win over Thomas Hearns as Barkley was about to be knocked out himself (skip to the 6:00 mark):
I remember seeing that fight and being totally stunned.
And for an Ozzy at the very height of his powers and armed with the songwriting genius of Randy Rhoads, here is "Tonight" as a special bonus:
ADDED
Huge News
In what can only be described as history altering news, NASA's picture of the day clearly was photoshopped to hide an alien spacecraft near the Saturn moons of Titan and Dione:

The picture on the right clearly shows a space craft with some kind of ion drive. Maybe E.T's need a bailout and heard this was THE galaxy for that?
Have a good night.
Sunday, April 18, 2010
Sunday Solution
Please bear with me this evening. Last night was boys night out; we went out for a LONG time and today I was OUT of commission for most of the day. To be young again! Lets go over the puzzle from Friday.
DNA Puzzle
I was surprised to find two correct solutions in the gmail today! Hats off to Au Soleil Levant and reader TS who both had the correct answer. I have communicated the possible winning prizes and await selection information.
Ok, so now the puzzle.
The submission was:
5'-GGCCGTGTATAGTCGCGGGTTATGTTG
GCCTTGTAAGACCATGCACGAAAACCG
CTACGCAAATACAAGGATAATGAGCGC
TCTCATTGCGAGTTGATCTGGCAGTGC
AGTTTCCGGAATTGGTGCGTGGCCAAT
TTTTTTTTTTTTTTTTT-3'
I mentioned the strong kozak leader would be in play.
5'-GGCCGTGTATAGTCGCGGGTTATGTTG
GCCTTGTAAGACCATGCACGAAAACCG
CTACGCAAATACAAGGATAATGAGCGC
TCTCATTGCGAGTTGATCTGGCAGTGC
AGTTTCCGGAATTGGTGCGTGGCCAAT
TTTTTTTTTTTTTTTTT-3'
Which gives us the target sequence:
5'-ACCATGCACGAAAACCG
CTACGCAAATACAAGGATAATGAGCGC
TCTCATTGCGAGTTGA-3'
The coding sequence shown in the triplets to be read:
CAC-GAA-AAC-CGC-TAC
GCA-AAT-ACA-AGG-ATA-ATG-AGC
GCT-CTC-ATT-GCG-AGT-TGA
Using your handy dandy codon chart reveals:
H-E-N-R-Y
A-N-T-R-I-M-S
A-L-I-A-S
So the hidden question was "Henry Antrims Alias"?
The answer is Henry McCarty, William H. Bonney, maybe Brushy Bill Roberts and of course......
Billy The Kid!
I hope anyone that tried it out had a good time.
Of course, the film Young Guns and Young Guns II featured Emilio Estevez as the outlaw:
The opening scene of Young Guns II features an older Billy the Kid making his plea for a pardon. Interesting indeed.
Welcome to the Light
My good friend that I was out with last night shocked me in that he had never heard the song "Children of the Grave" featuring Randy Rhoads on the Tribute Album. When we got back in I loaded up the tune and he was blown away! The entire album features the true genius of Rhoads and this song showcases his ability to give motion and meaning to a song in a live performance. This tune and "Crazy Train" from the Tribute album are the finest guitar works I have ever heard and I love it!:
Go to the 3:00 minute mark and enjoy!
Have a good night.
DNA Puzzle
I was surprised to find two correct solutions in the gmail today! Hats off to Au Soleil Levant and reader TS who both had the correct answer. I have communicated the possible winning prizes and await selection information.
Ok, so now the puzzle.
The submission was:
5'-GGCCGTGTATAGTCGCGGGTTATGTTG
GCCTTGTAAGACCATGCACGAAAACCG
CTACGCAAATACAAGGATAATGAGCGC
TCTCATTGCGAGTTGATCTGGCAGTGC
AGTTTCCGGAATTGGTGCGTGGCCAAT
TTTTTTTTTTTTTTTTT-3'
I mentioned the strong kozak leader would be in play.
5'-GGCCGTGTATAGTCGCGGGTTATGTTG
GCCTTGTAAGACCATGCACGAAAACCG
CTACGCAAATACAAGGATAATGAGCGC
TCTCATTGCGAGTTGATCTGGCAGTGC
AGTTTCCGGAATTGGTGCGTGGCCAAT
TTTTTTTTTTTTTTTTT-3'
Which gives us the target sequence:
5'-ACCATGCACGAAAACCG
CTACGCAAATACAAGGATAATGAGCGC
TCTCATTGCGAGTTGA-3'
The coding sequence shown in the triplets to be read:
CAC-GAA-AAC-CGC-TAC
GCA-AAT-ACA-AGG-ATA-ATG-AGC
GCT-CTC-ATT-GCG-AGT-TGA
Using your handy dandy codon chart reveals:
H-E-N-R-Y
A-N-T-R-I-M-S
A-L-I-A-S
So the hidden question was "Henry Antrims Alias"?
The answer is Henry McCarty, William H. Bonney, maybe Brushy Bill Roberts and of course......
Billy The Kid!
I hope anyone that tried it out had a good time.
Of course, the film Young Guns and Young Guns II featured Emilio Estevez as the outlaw:
The opening scene of Young Guns II features an older Billy the Kid making his plea for a pardon. Interesting indeed.
Welcome to the Light
My good friend that I was out with last night shocked me in that he had never heard the song "Children of the Grave" featuring Randy Rhoads on the Tribute Album. When we got back in I loaded up the tune and he was blown away! The entire album features the true genius of Rhoads and this song showcases his ability to give motion and meaning to a song in a live performance. This tune and "Crazy Train" from the Tribute album are the finest guitar works I have ever heard and I love it!:
Go to the 3:00 minute mark and enjoy!
Have a good night.
Labels:
DNA Puzzle,
Ozzy,
Randy Rhoads Tribute,
Sunday Solutions
Subscribe to:
Posts (Atom)