Showing posts with label Randy Rhoads Tribute. Show all posts
Showing posts with label Randy Rhoads Tribute. Show all posts

Tuesday, September 27, 2011

The Song that Changed My Life

The market rallied huge this morning, but I could not even see the volume bar for the SPY in Finviz. Sure enough a huge fade late in day made the whole thing suspect. It's still not a market you do anything but day trade, or maybe find high value stocks to buy and hold for a long time. As such, I don't have much to offer tonight on markets. Let's see if this will interest you.

The Song that Changed My Life
This post is inspired by a Twitter question as well as Dinosaurtrader's awesome post about the 20 year anniversary of Nirvana's Nevermind album.

I have always been a bit different than most people I grew up with. Most of the time it did not matter too much, but sometimes it did. Most of my friends were playing football and baseball, or joining gangs and getting in trouble around grade 5 in 1987. I don't like all the pads in football, I hate baseball, and Lowell was not a kind place for idiots back then. I don't know exactly how things may have turned out if not for watching Mtv one day when I was 11. Who can know such things?

Here is a list of the top 100 songs of 1987. You can see Bon Jovi, Posion, and other glam rock was well represented. I loved that stuff and I still do. But as I awaited the top 20 video countdown to come on (no YouTube!!) I was hoping Bon Jovi was still in the #1 spot. Ozzy Osbourne had just released his album "Tribute" which featured Randy Rhoads on lead guitar before his death. All I thought I knew about Ozzy at the time was that he worshipped the devil or something. Pass. Until the song opened up:

And I was stunned. I listened to the whole thing in silence and awe. I had never heard anything so powerful and raw. I couldn't move, I knew this was always going to be my favorite song and that I was meant to have found it.

I dashed out of the house when it was done and rode my bike 4 miles downtown to the tape store (yes a tape store) to get a copy. I listened to it until it broke. I am serious, it got overheated and broke. I was pissed, tapes were not cheap.

So how did this change my life other than expose me to heavy metal? Because everyone I knew hated the music and thought it was stupid. They all cracked on me to no end. This may sound silly, but when you are 11 what your "friends" think is huge. You could get left out by just the clothes you wear or the music you listened to. I didn't care. I knew this was my song, my music, my call.

And I have never worried about what other people think since. A couple years later I started riding my bike way across town to the West End Gym (the old one on Powell street) and started boxing, something I always wanted to do but my mother forbade it (It would be years until my mother found out). No one I knew would go with me, they all thought I was crazy. But I knew it was right for me. I knew what I wanted.

And on and on. To this day I still have 3 unopened CD copies of the Tribute album just in case I need them. There is one in the car as well. Ok, maybe that's a bit creepy. But I owe my independence to Ozzy and Randy, least I could do is buy a few albums.

Have a good night.

Saturday, June 25, 2011

Saturday Night Live

The game last night was fun and I got to see Champion Boston Bruin Shawn Thornton up close as well. It did light rain all night, but what can you do?

Saturday Night Live
No Friday, no problem! Just move the show to Saturday night.

Dusty - The Cat Burglar!
This cat has stolen over 600 items over 3 years. Near the end of the clip there is surveillance footage of him bringing home stolen things, amazing:


Cartoon Funny?
All those tales of innocent cartoons holding hidden jokes are true:
epic fail photos - Rocky and Bullwinkle FAIL
see more funny videos, and check out our Yo Dawg lols!
Not nice.

Why Teenage Boys Want Picture Phones
They can come in handy:
photobomb that guy - 'I'm Going to Be Tumblr Famous For This One'
see more This is Photobomb

Cool Stuff
-You may have seen the stone city of Petra in the third Indiana Jones film:
-The Ancient Pueblo People in the US Southwest also used stone as a place to build a city:
-At least this guy GETS IT:
Robopocalypse by Daniel H. Wilson

Film Clips
Some sections of cinema you may like.

OK, not a film, but one of my all time favorite Highlander episodes was "Forgive Us Our Trespasses". This episode explores how muddled one's history can become when you live for 100's of years. In this episode the main character Duncan Macleod is hunted down over time by the friend of man Macleod killed years ago in the British-Scottish wars. Skip on to the last 10 minutes, starting at 39:33 and see how well acted and moving this series could be at times:

"With my shield or on it." So classic.

In an era when pretty much every film was court related in some way, one of the better ones was "Presumed Innocent" starring Harrison Ford. I could only find a crappy quality trailer, but this film is a must see:


Rock Blogging
Making music breaks since 2007.

My friend C-T requested this strange video of "Fire Water Burn" by The Bloodhound Gang and the video is really funny:

Where did you see that one C-T??? Nice.

Gawains reminds me that I once lost a bet for money to my wife because I was SO sure The Grateful Dead performed "Don't Fear the Reaper" but it was Blue Oyster Cult, ugh:

With a little "The Stand Action".

How about Pee Wee Herman's rendition of "Tequila", sorry, no embed available!

Found this super great live performance by Lynyrd Skynyrd for "Simple Man":

WOW!!!!!

Ok, two tunes left.

A little Megadeth with "Hangar 18":

Not bad at all.

For last call I wanted to play a tune I have had up before. Last weekend I listed it over at the 12631 Pelican Room and I was surprised how many had not heard it, and really happy with the response to it!

I had a whole paragraph I was going to write about this selection, but I will be brief. Readers know Randy Rhoads is in my estimation the greatest guitar player of all time. To hear him give new life and a new temp to a Black Sabbath classic like "Children of the Grave" is one thing, yo get it live is pure joy. This weekends must hear (and LEAVE an opinion on this, I want to hear you!) is when Randy cuts loose at the 3:00 mark and to this day it is in the top 2 for greatest works ever for me:

Just unreal.

Have a good night.

Sunday, April 18, 2010

Sunday Solution

Please bear with me this evening. Last night was boys night out; we went out for a LONG time and today I was OUT of commission for most of the day. To be young again! Lets go over the puzzle from Friday.

DNA Puzzle
I was surprised to find two correct solutions in the gmail today! Hats off to Au Soleil Levant and reader TS who both had the correct answer. I have communicated the possible winning prizes and await selection information.

Ok, so now the puzzle.

The submission was:

5'-GGCCGTGTATAGTCGCGGGTTATGTTG
GCCTTGTAAGACCATGCACGAAAACCG
CTACGCAAATACAAGGATAATGAGCGC
TCTCATTGCGAGTTGATCTGGCAGTGC
AGTTTCCGGAATTGGTGCGTGGCCAAT
TTTTTTTTTTTTTTTTT-3'

I mentioned the strong kozak leader would be in play.

5'-GGCCGTGTATAGTCGCGGGTTATGTTG
GCCTTGTAAGACCATGCACGAAAACCG
CTACGCAAATACAAGGATAATGAGCGC
TCTCATTGCGAGTTGATCTGGCAGTGC
AGTTTCCGGAATTGGTGCGTGGCCAAT
TTTTTTTTTTTTTTTTT-3'

Which gives us the target sequence:
5'-ACCATGCACGAAAACCG
CTACGCAAATACAAGGATAATGAGCGC
TCTCATTGCGAGTTGA-3'

The coding sequence shown in the triplets to be read:
CAC-GAA-AAC-CGC-TAC
GCA-AAT-ACA-AGG-ATA-ATG-AGC
GCT-CTC-ATT-GCG-AGT-TGA

Using your handy dandy codon chart reveals:
H-E-N-R-Y
A-N-T-R-I-M-S
A-L-I-A-S


So the hidden question was "Henry Antrims Alias"?

The answer is Henry McCarty, William H. Bonney, maybe Brushy Bill Roberts and of course......
Billy The Kid!

I hope anyone that tried it out had a good time.

Of course, the film Young Guns and Young Guns II featured Emilio Estevez as the outlaw:

The opening scene of Young Guns II features an older Billy the Kid making his plea for a pardon. Interesting indeed.

Welcome to the Light
My good friend that I was out with last night shocked me in that he had never heard the song "Children of the Grave" featuring Randy Rhoads on the Tribute Album. When we got back in I loaded up the tune and he was blown away! The entire album features the true genius of Rhoads and this song showcases his ability to give motion and meaning to a song in a live performance. This tune and "Crazy Train" from the Tribute album are the finest guitar works I have ever heard and I love it!:

Go to the 3:00 minute mark and enjoy!

Have a good night.