A Few Thoughts

Out of any real time so just a couple of thoughts.

What is the Story on Volume?
When you start getting to a place where things are out of hand, say after a non stop train ride to old stock highs, people get a little dizzy and start making things up to match something they see. Take volume during the stock market run up. It has been low. It has been really low. Days of UP moves (every day) are very light and days of DOWN moves are light, but heavier than the UP days. I can read a volume chart thanks. Of course you can see some other takes.

Barry Ritholtz notes that John Roque offers:

“Volume has been a curiosity for most and a problem for others. On an absolute basis, 2010 volume is averaging about 4.7 billion shares/day. This is down 15% vs. the 2009 average NYSE volume of 5.5 billion shares/day. Yet 2010’s average volume is only slightly less than the 2008 average of 4.96 billion shares/ day.”

Sounds reasonable.

The chart provided has some useful information:


A comment left hit the bases I wanted to cover:

flipspiceland Says:
April 14th, 2010 at 1:11 pm
How much of the volume is being generated by just a few entitties? vs 2008
How much of the volume is concentrated in Citibank? vs 2008

Good questions indeed. The same stocks are heavily traded, and I mean heavily traded. Banner names like AIG, FNM, FRE, C, BAC to name a few.

Another comment summed up the HFT angle:

crunched Says:
April 14th, 2010 at 3:01 pm
None of these points mean anything because the proliferation of HFT and Program trading has expanded beyond measure SINCE 2008. If you factor out all the computers trading against each other for the sole purpose of rebates, every hedge fund inching the market higher based on their latest algo, the Trading desk at the Federal Reserve spending all our tax dollars pumping up name-brand ETFs so Joe Sixpack will buy stocks again… there isn’t much volume left. Hardly any, in fact.

Of course there is no real way to get an accurate HFT trading number, but certainly this is a factor as well.

One more from me. For all the "Rate of Change" maniacs that get all sweaty because some bad number is getting less bad more slowly, please note the RATE OF CHANGE FOR VOLUME IS GOING THE WRONG WAY! Sorry to yell, but it amazed me how intellectually bankrupt most people are. Also, the first year over year outright contraction in 18 years. But volume is the same. What ever.

Of course the mess that occurred in the bust was a factor in volumes for dog stocks. But even now some of the small change stocks command sometimes 25% of a days trading volume. Seems weird to me but I am an amateur. Two 5 year charts to think about the volume angle:
Citigroup (C):

Nothing strange there in regards to volume.

AIG:

Again, very normal. You have to squint to see the huge volume before the last two years, but it is there.

Look, maybe the new bull market will be in backstopped firms and those volumes mean more, but to pretend the market is internally backed up by the volume numbers is a stretch.

Where is the Money Coming from?
As we all know we are now in the midst of a new consumption spree and people who just a short time ago could not pay their mortgage now have money to blow on goods of all kinds, and not just higher priced gasoline. With a lack of job creation, wages stuck at neutral or in reverse, and no ay to make any money unless you want to play the stock market, just where is this money coming from anyway? Surely if everyone has enough cash to blow on an Ipad, they could maybe pay their mortgage instead and get me off the hook for it? Just a suggestion.

I have been skeptical that defaulting borrowers (all kinds) were behind this new drive of buying, but I am warming up to the idea. Last week in the comments reader Moneta did come envelope math and found:

You will find delinquency rates.
http://www.federalreserve.gov/releases/chargeoff/

Delinquency Rate (Residential RE):
4Q2009 = 10.80%
2Q2008 = 4.15%
2Q2005 = 0.07%

Let's say there are 110 million households in the US and 40% are mortgage free. That means 66M have a mortgage.

If 11% are not paying, it's probably those who have a huge mortgage because the others would want to keep their house.

So 1500$ * 12 = 18K per year + 3K in taxes = 21K in new found money per hh.

7.25 million * 21K = 150 billion ore for consumer goods.

Plus don't forget the thousands per household that were being spent on real estate and going into private fixed investment. Now a lot of this money is probably going into consumption... who would anyone want to put more money than they need to in a depreciating asset?

Let's say 25 million households are putting 5K less towards fixed investments, that would give them 125B more to spend on consumer goods.

Not a bad estimate in round terms and I noted at the time that numbers like that made it possible. I was still not 100% sold though.

Today another estimate comes out, and it is not very far from Moneta's guess (via Zero Hedge):
The Benefits Of Contract Abrogation According To Mark Zandi: 6 Million People Not Making Mortgage Payments Frees Up $8 Billion Each Month
Diana Olick get's Mark Zandi's take (yes, that Zandi! Do a search he pops up plenty here!) and his guess is that maybe 8 Billion a month is set free after mortgage default:

Diana Writes:
Then I decided to ask Mark Zandi, of Moody's Economy.com, who will often shoot down my more ridiculous theories.

I asked him if this was a crazy idea:

"No, not crazy. With some 6 million homeowners not making mortgage payments (some loans are in trial mod programs and paying something but still in delinquency or default status), this is probably freeing up roughly $8 billion in cash each month. Assuming this cash is spent (not too bad an assumption), it amounts to nearly one percent of consumer spending. The saving rate is also much lower as a result. The impact on spending growth is less significant as that is a function of the change in the number of homeowners not making payments.

I'm not sure I would say this is juicing up spending, but resulting in more spending than would be the case otherwise.

Many of these stressed homeowners (due to unemployment) are reducing their spending, just not as much as they would have if they were still making their mortgage payment."

Not too far from the reader math!

Of course Mr. Zandi is always an optimist. In regards to defaulters blowing their new found cash as we all have to pay for their home (one way or another) he offers this gem:

"In some sense there might be a silver lining in that."

Well we have that going for us, which is good.

All of this makes me want to throw up. Will Ben Bernanke ever have to answer a question on this issue? Moral Hazard is a nasty thing and I never even thought of this angle. The new bull market may be in "strategic defaulters". Which stocks to buy then, retailers? Oh wait, have you seen the run retailers are on? Forget I said anything.

Have a good night.

Something to Think About

I forgot that today is Friday! As always, I will be presenting the usual Friday night festivities, an extended one tonight as I am not motivated to write about fiance this evening except for one thought.

Something to Think About
As I am sure everyone knows, the small city-center of Dubai is trying to delay payments on debt which may or may not constitute a debt default. There was some degree of panic across the world markets on the news because after all, things like this don't happen in the midst of a robust recovery like the one we are told we are in. All eyes turned towards the US market open today to see how bad things were going to get.

Answer: Not bad at all.

Yes, the indices all ended lower by about 1%, but there was no real force behind the selling. It almost seemed staged; something like "this Dubai news is bad, we should sell off a bit to show a good face".

Here is my take on the whole thing. Over the last week we have seen severe credit/debt/currency stress headlines. Items include the Dubai issue, Greece CDS, Vietnam devaluing by 5%, and new increases in personal bankruptcy. None of these things make a difference even though they should. Why you might ask? The answer is very simple:

Everyone everywhere now firmly believes that there will not be any shock to the system that a government will not bailout.

Example, from Clusterstock today:
JP Morgan: Stop Freaking Out, The UAE Can Easily Save Dubai
No worries if the biggest waste of construction in the middle east is going down, the UAE government will step in and make HSBC (among others) whole. If not the UAE, any exposure JP Morgan may have would qualify under the "too big to fail" category and promptly be backstopped.

This is leading to a dangerous mindset. Market participant s are almost cocky right now and placing bets under the idea that one cannot lose. When I tried in vain to get Moral Hazard discussed over the last year and a half, this is what I had in mind. Want to finance a huge water park in the middle of the Sahara Desert? What? Nobody came to go on the slip and slide? The property is now worth only 30% of the old price? No worries, bond holders will be made whole and no lasting damage will be allowed to the banks.

Expect this to manifest itself in news ways as market players use the FED/Treasury pledge of never ending support to trade against.

Friday Night Entertainment
A bit of entertainment to start the official weekend.

Picture Pages
"Picture pages, picture pages, time to get your picture pages, time to get your markers and your pencils!"

You Are Being Watched

see more Lolcats and funny pictures

Is this a beautiful princess?:

see more Epic Fails
I say NO.

Film Clips
Some more cinematic masterpieces.

From a discussion elsewhere I was reminded of the dark humor film "Heathers" which is a must see:


All the poker talk put me in the mind of "Rounders" widely regarded as launching Texas Hold Em into the stratosphere. Enjoy this scene:

"Not hungry?" Classic.

If you have not seen "Revolutionary Road" then you have not seen a modern classic:


Rock Blogging
Some music to end the show.

Housing Doom had a Johnny Cash song posted for Thanksgiving and that put "It Ain't Me Babe" on my radar. I really love the version form the film Walk the Line so check it out:


Now everyone knows Economic Disconnect is a huge hair band fan. Enjoy the power anthem "Somebody Save Me" from Cinderella:

I saw these guys live at a show in 1999 and they sound the same live as their studio album.

Another stellar live show performer is Depeche Mode. Take a listen to "Enjoy the Silence":


One of my favorite songs is Don Henley's "The Boys of Summer":

Nice HD version.

Last call! Final curtain call.

When Motley Crue had their big comeback album, "Dr. Feelgood" there where plenty of songs that got all the headlines. The best song on the album, in my opinion, is "Wildside" though it is not as well known:

NICE! Love this song.

Have a good night.

Maybe We Should Have Had that Moral Hazard Talk After All

Another week for the history books with more drama than a Danielle Steel novel! I hope this site has helped you stay informed, entertained, and prepared for all that has happened and for that which is to come.

Fraud, Fraud, and then a Side Dish of Fraud
I am becoming numb to the never ending parade of news stories about fraud and a total collapse of ethics. Still, we must pay attention (hat tip Jesse's Cafe):

Merrill review spots trading 'irregularity'
7 Mar 2009, 0047 hrs IST, Bloomberg
LONDON: Merrill Lynch & Co, the securities firm acquired by Bank of America Corp, said it uncovered an “irregularity” during a review of its
trading operations.
The bank informed regulators immediately of the discrepancy in “certain trading positions”, Merrill Lynch said in a statement from London. The bank said it’s working with the authorities to investigate further. A spokeswoman for the bank declined to comment further.
Merrill Lynch may have lost hundreds of millions of dollars on currency trading and credit derivatives last year, the New York Times reported earlier on Thursday.
The losses did not “spill into plain view” until after Bank of America investors had approved the $33 billion takeover in December and Merrill Lynch disbursed $3.6 billion in bonuses to bankers, the newspaper said. Bank of America later sought additional government funding. “Senior managers of the business are focused on the issue and believe the risks surrounding possible losses are under control,” Merrill Lynch said in the statement.

Get some metamucil for this "irregularity"! Looks like another Merrill Lynch sweep-it-under-the rug- play before they were taken over by Bank of America.

Before this is all over I think that the level of fraud and corruption revealed will probably end investor faith in any but the most transparent vehicles. That is a good thing, and it offers a nice way for a new trader business to step in and fill the void. What a mess.

The Song Remains the Same
Writer Yves Smith of Naked Capitalism had a note up today explaining that she is taking a reduced blogging role over the next months to work on a book project. I wish her well and I will be first in line to buy the book!

Yves had a line in her post that struck as very familiar:

"Maybe I am getting burned out from the crisis, but I feel too much of my commentary keeps circling back to the same topics. The problems are not going away, and even if there are new news hooks, the themes aren't changing all that much, the bad policies, the bad assets, the lack of will to reform, the doublespeak. I suppose in times like these, making sure one is not part of the problem and doing what one can, even in a small way, to get things on a better path is a contribution. But the trajectory of policy seems immune to public opinion and reason."

I concur. We discuss to no end the same problems over and over and yet nobody in a position to do something seems to have any clue. We know that the new administration watches CNBC (public words about Santelli and Cramer) so why not read a few blogs? If the FED-Treasury-White House spent 3 hours today on Calculated Risk, Mish's site, and Naked Capitalism they might grow a brain. One can dream.

Also on Naked Capitalism today is a scathing piece that states that the current Treasury head's handling of the Asian Crisis may not have been the "slam dunk" success it was made out to be. Fascinating stuff.

Maybe We Should Have Had that Moral Hazard Talk After All
To me, the most shocking and infuriating event of the current debacle was how in the space of about 2 days there was a move made from starting to think about moral hazard to acceptance that it did not matter. I mean, in 2 days the whole concept of rewarding and propping up total failures was glossed over. To this day I am most disappointed with that shortcoming.

It seems there may be a little bit of regret out there, small as it may be, that moral hazard was ignored. Calculated Risk has extensive excerpts from Kansas City Fed President Thomas Hoenig that are well worth a review.

Key point:

"If an institution’s management has failed the test of the marketplace, these managers should be replaced. They should not be given public funds and then micro-managed, as we are now doing under TARP, with a set of political strings attached."

Welcome to the party Mr. Hoenig!

If nobody is scared to make mistakes because they have a guaranteed backstop, they will behave very differently than if they are on their own. As I have said before, do not cry and moan that the free market has led us to this point, we have not had a free market in some time. The big banks knew it and took full advantage. The FED and the Treasury have been played for suckers, which would be both funny and just fine except the only money they have to waste is OUR MONEY! Thus it is just sad and cruel.

Friday Night Entertainment
A little light on material tonight as it took me a little while to compose and re check tonights DNA based cipher puzzle!

Puzzle Number Two
Last Friday I put up a puzzle that used the DNA bases to translate out into words a message. You may want to review the instructions from last week as they apply to the new puzzle as well.

First off, I will not post a solution until Sunday afternoon, around 5pm. I would ask anyone that gets the puzzle done to refrain from posting a full solution but if you have it done add up the numbers used in the message and post the total in the comments section. This way I can tell who got it first without giving the message away. If you are first, just think of what you would gain:
-You could put the accomplishment on your resume; I would lead with it myself
-You will be the envy of the Economic Disconnect community (all 50 of us!)
-You will be the toast of all your friends and co-workers
With all that on the line, you should all be sharp! On to the instructions:

Last week the DNA started right off by coding for a message. Not so easy this time. The sequence is split into two sections.

Section One
Last week I went over how all genes start with the sequence ATG which codes for amino acid methionine (M). It still applies, but this time there has to be an element known as a Kozak Sequence directly before the ATG. Only a high strength Kozak will start a gene reading. I will not tell you what a Kozak sequence looks like, you will have to find out. Here is the sequence first section and remember the M will not be part of the message:

5'-AAGGAATGACACTCTGGAAATGACAGCACCCG
GATTGGATGCCCTGTACTCCAGCGCGTCTCGGAG
CCACCATGACACATGAGTGGATTAATAACATCA
ATGGTGATATCGGCATAACGTCCGCCAGGGAA-3'

Section Two
Ok, if you got the first section right the second section reads right through, I mean that the first 3 bases of section two are the next letter of the message, no start needed. The new wrinkle here is that I have split up the sequence by intron-exon boundaries. Introns are sections of DNA that are not used in a message, but are interspersed in a gene sequence. The introns are spliced out by enzymes. The intronic regions are notated with small letters instead of CAPS. To complete the second section you must take out the introns to get a complete message. Be careful to reassemble your DNA fragment in frame!:

5'-GAGATTattcgggggcccttttaaacgGGACATACAAACAtgg
ggcccccgtggctTCAAccccaaaattttgggtgtgaatgcTGAAACTGggt
taaggccttaagggcgtAGAATTGAggccttaagcgcgctta-3'

I will of course answer any clarification questions as I know this can be a bit much to take in! Have at it!

Friday Night Rock Blogging
Wow, that took a while to write! On to the music!

Reader Kevin requests a song called "Road to Hell" by Chris Rea and I must say it is a good one! Anyone that plays guitar with a slide is awesome and the song is very thoughtful:


While watching the Oscar winning film "Point Break" I heard a song in the background that I really liked. After some detective work, pleae enjoy L.A. Guns and "Over the Edge":


What do you get if you cross unreal vocals with unreal music and lyrics? You might get "Wheel in the Sky" by "Journey":


Heard this one on the radio on the way home. Complete with old school TV performance of "Turn Me Loose" by "Loverboy":


Last call! Markets have you down? Things are getting scary? Feel like you went 15 rounds in a fight and lost? Well pick yourself up and get back at it, next week. Special inspiration provided by Bill Conti:


Have a good night!