Friday Economic Recap
There were a couple of things I wanted to highlight, but I will be brief as I am getting more and more jaded on things as of late.
Goldman Sachs Charged by SEC
By now you must have read about Goldman being charged by the SEC for their sale of a set of CDO's that GS may have not fully been up front about. The charge is fraud. I have looked over the details and I think that in the strict letter of the law sense, Goldman would win a legal battle. The spirit of the law was bent about as far as it could go and this could cause problems for GS as well. Selling garbage and then betting on it's collapse (I am not talking about Greek debt sales by GS!) is pretty dirty, but probably legal in some way that is beyond me.
My favorite headline of the day, via EconomPic:
Goldman's Stock Crushed.....All the Way to Last Month's Level
Awesome! Shows how far stocks have been running as of late.
Goldman has come out swinging but really they should pay the 50 million dollar fine or whatever it will be and move on. If this gets into court they will have to detail more and more of their transactions and that could cause a real issue for their public relations.
I have seen a few places that Goldman may have, I repeat, MAY HAVE shorted their own stock and/or futures based on a heads up by the SEC. Now if that turns out to be the case, GS has no wiggle room and has broken the law in every sense. We can all hope this was the case!
Everyone is Stupid But One Guy
You know I have no idea why people seem to annoy me all at once, but Barry Ritholtz does it again!
Today Barry pens:
Are Defaults Really Driving Retail Spending?
I was interested in the piece because I have spilled some ink on this as of late. As I have written, I was skeptical at first but have warmed up to the idea based on some number crunching submitted by reader Moneta and some articles by Diana Olick and Edward Harrison. I looked forward to another take.
Well Barry goes nuts on a Housing Wire article that focused on one example of a HAMP applicant that went crazy with spending. Fair enough, one example does not make a fact. Then Barry goes off the deep end:
A few of the usual brain dead media suspects picked up his post as proof of some talking point or another. Merely repeating other people’s weak ass comments isn’t news — its somewhere betweenWell now you know.
Disappointingly, Diana Olick of CNBC also got drawn into the silliness. her work is more often than not excellent. Not this time, omitting both in depth research into retail sales and analysis of the actual data.
She should know better
Barry Ritholtz has offered up his perfect analysis of retail sales and finds that defaulters have zero effect. What are his data sources? We don't know. How does he figure out how much money may be freed up? No explanation. Barry just calls anyone thinking this is possible brain dead. The Edward Harrison piece I linked yesterday had numerous examples, not one, but Barry never got around to finding that one. Barry states his interpretation of data as fact. Barry has been keen on pointing out everyone else's bias for a few weeks, so let me help him out:
If you think your interpretation of data is perfect and everyone else is wrong you have a blind spot.
Seriously, this was way out there. Maybe time to update the Must Read blogroll, again. Any ideas on a replacement? Leave ideas in the comments.
Friday Night Entertainment
Indeed it is time for a little unwind!
DNA Puzzle Return
A while back I started a few DNA based puzzles for the readers to solve and I think it was fun, though folks found it hard. I have been doing this stuff for so long I can almost see the amino acid letters in DNA sequence. I told you I needed a vacation!
Anyways, here is the first post I did and it has the keys you will need to translate tonight's puzzle and another post which explains the Kozak sequence. This puzzle will have a strong kozak, a start signal (the M letter will not factor into the puzzle, ignore it) and a stop codon where the message ends. I have hidden the message among decoys so good luck!
5'-GGCCGTGTATAGTCGCGGGTTATGTTG
GCCTTGTAAGACCATGCACGAAAACCG
CTACGCAAATACAAGGATAATGAGCGC
TCTCATTGCGAGTTGATCTGGCAGTGC
AGTTTCCGGAATTGGTGCGTGGCCAAT
TTTTTTTTTTTTTTTTT-3'
The solution is a question that you must answer as well! Email me your response (as not to blow it for everyone else) to the gmail at the left and perhaps a prize will be involved. No cheating! Solution will be posted on Sunday if no takers are found.
Picture Time
Visual comic relief.
The true talent of the Beatles Cat style:
see more Lolcats and funny pictures
Spell Check needed:
Wii Can be Dangerous
Now I know plenty of people love the Nintendo Wii and I feel it is my obligation to report any risk issues with the product. I submit, without comment, the following advisory:
Wii Fit injury turns woman into a sex addict!
Careful out there!
Film Clips
Have not had a film clip in a bit.
Josey Wales meets Lone Watie in "The Outlaw Josey Wales":
Love that scene.
Rock Blogging
As always, it is 3am Eternal here and it is music time, thanks KLF for the intro!
Lurker suggested Al Stewart and "Year of the Cat" which I had never heard:
Not bad at all! Lurker knows some tunes.
Sorry to Gawains, but Jethro Tull is a no go. I never could forgive the Grammy Award travesty when Tull beat out Metallica for the "Hard Rock" award many years ago!
Watchtower wonders if I would play "Layla" by the genius Eric Clapton. Wonder no more:
Sweet version too!
My commute home was long on a Friday due to rain, but a super sweet double header on 93.7 Mike FM made the journey easy. Back to back classics! First off was Dire Straits and "Sultans of Swing". Next up was The Eagles with "Hotel California", and I flipped a coin so you get the Eagles (acoustic version):
Brett Michaels, the lead singer of the mega band Poison, had an emergency appendectomy this week. I wish him all my best and I KNOW you do too! HA! In honor of his recovery I offer Poison and "I Won't Forget You":
Love it!
A little Guns and Roses goes a long way. Take a walk through "The Garden" with Alice Cooper on back up vocals:
Last call! What to close the curtain with???? You all think this is easy, but it is not!
Now understand that I have NO IDEA why this song was stuck in my head most of today, but I do what the voices in my head tell me too (most of the time!). Closing the night with the get up and get crazy fun tune "Let The Music Play" by Shannon:
You gotta get groovy on that one!
Have a good night.
