Please bear with me this evening. Last night was boys night out; we went out for a LONG time and today I was OUT of commission for most of the day. To be young again! Lets go over the puzzle from Friday.
DNA Puzzle
I was surprised to find two correct solutions in the gmail today! Hats off to Au Soleil Levant and reader TS who both had the correct answer. I have communicated the possible winning prizes and await selection information.
Ok, so now the puzzle.
The submission was:
5'-GGCCGTGTATAGTCGCGGGTTATGTTG
GCCTTGTAAGACCATGCACGAAAACCG
CTACGCAAATACAAGGATAATGAGCGC
TCTCATTGCGAGTTGATCTGGCAGTGC
AGTTTCCGGAATTGGTGCGTGGCCAAT
TTTTTTTTTTTTTTTTT-3'
I mentioned the strong kozak leader would be in play.
5'-GGCCGTGTATAGTCGCGGGTTATGTTG
GCCTTGTAAGACCATGCACGAAAACCG
CTACGCAAATACAAGGATAATGAGCGC
TCTCATTGCGAGTTGATCTGGCAGTGC
AGTTTCCGGAATTGGTGCGTGGCCAAT
TTTTTTTTTTTTTTTTT-3'
Which gives us the target sequence:
5'-ACCATGCACGAAAACCG
CTACGCAAATACAAGGATAATGAGCGC
TCTCATTGCGAGTTGA-3'
The coding sequence shown in the triplets to be read:
CAC-GAA-AAC-CGC-TAC
GCA-AAT-ACA-AGG-ATA-ATG-AGC
GCT-CTC-ATT-GCG-AGT-TGA
Using your handy dandy codon chart reveals:
H-E-N-R-Y
A-N-T-R-I-M-S
A-L-I-A-S
So the hidden question was "Henry Antrims Alias"?
The answer is Henry McCarty, William H. Bonney, maybe Brushy Bill Roberts and of course......
Billy The Kid!
I hope anyone that tried it out had a good time.
Of course, the film Young Guns and Young Guns II featured Emilio Estevez as the outlaw:
The opening scene of Young Guns II features an older Billy the Kid making his plea for a pardon. Interesting indeed.
Welcome to the Light
My good friend that I was out with last night shocked me in that he had never heard the song "Children of the Grave" featuring Randy Rhoads on the Tribute Album. When we got back in I loaded up the tune and he was blown away! The entire album features the true genius of Rhoads and this song showcases his ability to give motion and meaning to a song in a live performance. This tune and "Crazy Train" from the Tribute album are the finest guitar works I have ever heard and I love it!:
Go to the 3:00 minute mark and enjoy!
Have a good night.
9 comments:
Now I am on a Trubute kick:
"Mr. Crowley"
http://www.youtube.com/watch?v=dPKwS3SbVVw
"Believer":
http://www.youtube.com/watch?v=9r6H8abOtgc
NICE!!!!!!!!
Well, GYC, as much as I admire Randy Rhoads--his work on the first two Ozzy albums was beyond brilliant--he did not write Children of the Grave. Nor did he ever play it better than Tony Iommi, the original author.
As per my last post, all I'm saying is you have to open your mind to music. Very few musicians can cover a song better than the original author. Elvis Presley and Joan Baez come to mind.
We can argue all night about whether Randy Rhoads could play better than Tony Iommi. That's debatable. But the real argument goes to the body of work.
Iommi invented heavy metal (actually heavy jazz, but that's another argument). He wrote most of the greatest songs in that genre. And he played them brilliantly.
Rhoads was a prodigy. (Something about Ozzy and his ability to attract great guitar players.) And his original work is some of the best. But he died too young, unfortunately.
However, Rhoads' covers of Iommi riffs lack the precision of the original. I guess you had to grow up on Black Sabbath to hear it, but it's there.
Also, Jethro Tull is one of the more brilliant bands of the era, musically and lyrically complex. Don't shut them out just because they beat out Metallica for a Grammy.
Anyway, I'm sick of reading about all of this nonsense about Goldman Sachs. This was a carefully coordinated political maneuver to make the current administration look like it's actually legislating financial reform. It's not. And the Dodd bill is a joke.
Nothing is going to change, not with this crew in charge. Goldman will pay a small fine or settle out of court, and continue to conduct business as usual.
Gawains,
no debate at all. I find it refreshing that you, as I do, really think Iommi made metal. I think that man a true genius!
All I was saying is that the song I posted may well be the best guitar work in my opinion, and I always have my bias! That tune just gets me all amped up and ready to go. Still, it lacks the kind of raw power that say the into to the song "Black Sabbath" has.
I agree, nothing is going to change on the financial front.
Congrats Au Soleil Levant and TS!
Well, I've seen Black Sabbath live four times--Never Say Die, Heaven and Hell (with Ronnie James Dio), Reunion, and Oz Fest.
All I can say is that when they came out in 1978, after Iommi's amp was fixed, they laid down the law. Two hours of the heaviest metal ever, played to perfection. That was the best set by any band I've seen. Truly mind blowing.
But the Reunion tour, in San Antonio twenty-odd years later, that was special also. They were on that night as well. But they weren't driven to prove something like they were in 78.
I never got to see Rhoads play live, wish I had. That boy could play the guitar. There's no telling what he would have accomplished by now if he were alive today. The world lost a lot the day he died.
But, yeah, Black Sabbath invented what we call heavy metal. It's amazing really. Four young guys from a working class neighborhood in Birmingham, England, invented an entirely new form of musical expression. I call it Apocalyptic Rock. No one, and I mean no one else, was doing anything like it at the time. Hell, they recorded their first album in only twelve hours on a shoe-string budget. And changed the world of music forever.
They were deeply underground for many years. No air play, no magazine coverage. The only way anyone knew who they were was if someone really cool played a record.
I first heard them in 1974, when I was in the 7th grade. I was at a friend's house, and his older brother came in and turned us on to his new album, Master of Reality. It changed my life, and to this day Black Sabbath remains one of my favorite bands. There's no one else like them.
Oh, by the way, GYC, did you know that before he formed Earth (later renamed Black Sabbath) with Butler, Ward and Osbourne, Iommi was the original guitar player for . . . wait for it . . . Jethro Tull. Yeah, he played with them for a couple of months, but left before they recorded an album.
There was a creative conflict between Iommi and Ian Anderson. Anderson demanded complete authority and total artistic control. All songs, down to the instrumentation, and lyrics written soley by him. But Iommi wanted to go in a different musical direction, so he left and invented heavy metal. Anderson replaced him with Martin Barre, who really is very good.
Now, if you want a reason to not listen to Jethro Tull, that's as good as any. But you're missing out on some excellent music. There was a period in the early 70s when Tull recorded a string of groundbreaking albums. Not as good as anything Sabbath was recording at the time, in my opinion, but better than a lot of other bands.
Gawains,
I actually did not know that! Very interesting. Have you read the Ozzy biopic, "I am Ozzy"? Not a bad histroy.
No, I haven't read that biopic. I did read the book insert in Black Box, which is the remastered set, though. It's very good.
By the way, much the same thing happened between Ozzy and Iommi in the late 70s, creative conflict. After a string of really good albums, from Master of Reality through Sabotage, Ozzy left the band. He rejoined after a short while to record Technical Ecstasy. Then left again, only to come back to record Never Say Die.
The conflict was that Iommi wanted to take the band in a more jazz oriented direction. If you listen to the earlier albums, then listen to Never Say Die, you can hear the difference. The music is much jazzier. (Although it's pretty heavy when played live.)
Ozzy wanted to stay metal. So he left the band in 79 and went out on his own. There is no denying that finding Rhoads helped establish Ozzy as a solo act. Those first two albums are incredible.
Meanwhile, Iommi, Butler and Ward got with Dio and recorded Heaven and Hell, returned to their roots. Ward left the band after that, not to return until Born Again with Ian Gillan, which is a pretty good album. My friend Dominic told me that was one of the best tours he's ever seen. I missed it though, so I can't say, but I respect his opinion.
Oh, and here's another little piece of trivia. The only guitar player Brian May would allow to play with Queen was . . . wait for it . . . Tony Iommi. Makes you think, doesn't it?
Congratulations on your wedding anniversary!
Have fun in the Bahamas!
My favorite Ozzy song is "Crazy train". There are others, but that one is the fave.
Have fun on vacation!!! I saved a couple of weeks to do something fun during the summer. I didn't use all of my vacation for skiing. LOL
Post a Comment