Friday Economic Recap
There were a couple of things I wanted to highlight, but I will be brief as I am getting more and more jaded on things as of late.
Goldman Sachs Charged by SEC
By now you must have read about Goldman being charged by the SEC for their sale of a set of CDO's that GS may have not fully been up front about. The charge is fraud. I have looked over the details and I think that in the strict letter of the law sense, Goldman would win a legal battle. The spirit of the law was bent about as far as it could go and this could cause problems for GS as well. Selling garbage and then betting on it's collapse (I am not talking about Greek debt sales by GS!) is pretty dirty, but probably legal in some way that is beyond me.
My favorite headline of the day, via EconomPic:
Goldman's Stock Crushed.....All the Way to Last Month's Level
Awesome! Shows how far stocks have been running as of late.
Goldman has come out swinging but really they should pay the 50 million dollar fine or whatever it will be and move on. If this gets into court they will have to detail more and more of their transactions and that could cause a real issue for their public relations.
I have seen a few places that Goldman may have, I repeat, MAY HAVE shorted their own stock and/or futures based on a heads up by the SEC. Now if that turns out to be the case, GS has no wiggle room and has broken the law in every sense. We can all hope this was the case!
Everyone is Stupid But One Guy
You know I have no idea why people seem to annoy me all at once, but Barry Ritholtz does it again!
Today Barry pens:
Are Defaults Really Driving Retail Spending?
I was interested in the piece because I have spilled some ink on this as of late. As I have written, I was skeptical at first but have warmed up to the idea based on some number crunching submitted by reader Moneta and some articles by Diana Olick and Edward Harrison. I looked forward to another take.
Well Barry goes nuts on a Housing Wire article that focused on one example of a HAMP applicant that went crazy with spending. Fair enough, one example does not make a fact. Then Barry goes off the deep end:
A few of the usual brain dead media suspects picked up his post as proof of some talking point or another. Merely repeating other people’s weak ass comments isn’t news — its somewhere betweenWell now you know.
Disappointingly, Diana Olick of CNBC also got drawn into the silliness. her work is more often than not excellent. Not this time, omitting both in depth research into retail sales and analysis of the actual data.
She should know better
Barry Ritholtz has offered up his perfect analysis of retail sales and finds that defaulters have zero effect. What are his data sources? We don't know. How does he figure out how much money may be freed up? No explanation. Barry just calls anyone thinking this is possible brain dead. The Edward Harrison piece I linked yesterday had numerous examples, not one, but Barry never got around to finding that one. Barry states his interpretation of data as fact. Barry has been keen on pointing out everyone else's bias for a few weeks, so let me help him out:
If you think your interpretation of data is perfect and everyone else is wrong you have a blind spot.
Seriously, this was way out there. Maybe time to update the Must Read blogroll, again. Any ideas on a replacement? Leave ideas in the comments.
Friday Night Entertainment
Indeed it is time for a little unwind!
DNA Puzzle Return
A while back I started a few DNA based puzzles for the readers to solve and I think it was fun, though folks found it hard. I have been doing this stuff for so long I can almost see the amino acid letters in DNA sequence. I told you I needed a vacation!
Anyways, here is the first post I did and it has the keys you will need to translate tonight's puzzle and another post which explains the Kozak sequence. This puzzle will have a strong kozak, a start signal (the M letter will not factor into the puzzle, ignore it) and a stop codon where the message ends. I have hidden the message among decoys so good luck!
5'-GGCCGTGTATAGTCGCGGGTTATGTTG
GCCTTGTAAGACCATGCACGAAAACCG
CTACGCAAATACAAGGATAATGAGCGC
TCTCATTGCGAGTTGATCTGGCAGTGC
AGTTTCCGGAATTGGTGCGTGGCCAAT
TTTTTTTTTTTTTTTTT-3'
The solution is a question that you must answer as well! Email me your response (as not to blow it for everyone else) to the gmail at the left and perhaps a prize will be involved. No cheating! Solution will be posted on Sunday if no takers are found.
Picture Time
Visual comic relief.
The true talent of the Beatles Cat style:
see more Lolcats and funny pictures
Spell Check needed:
Wii Can be Dangerous
Now I know plenty of people love the Nintendo Wii and I feel it is my obligation to report any risk issues with the product. I submit, without comment, the following advisory:
Wii Fit injury turns woman into a sex addict!
Careful out there!
Film Clips
Have not had a film clip in a bit.
Josey Wales meets Lone Watie in "The Outlaw Josey Wales":
Love that scene.
Rock Blogging
As always, it is 3am Eternal here and it is music time, thanks KLF for the intro!
Lurker suggested Al Stewart and "Year of the Cat" which I had never heard:
Not bad at all! Lurker knows some tunes.
Sorry to Gawains, but Jethro Tull is a no go. I never could forgive the Grammy Award travesty when Tull beat out Metallica for the "Hard Rock" award many years ago!
Watchtower wonders if I would play "Layla" by the genius Eric Clapton. Wonder no more:
Sweet version too!
My commute home was long on a Friday due to rain, but a super sweet double header on 93.7 Mike FM made the journey easy. Back to back classics! First off was Dire Straits and "Sultans of Swing". Next up was The Eagles with "Hotel California", and I flipped a coin so you get the Eagles (acoustic version):
Brett Michaels, the lead singer of the mega band Poison, had an emergency appendectomy this week. I wish him all my best and I KNOW you do too! HA! In honor of his recovery I offer Poison and "I Won't Forget You":
Love it!
A little Guns and Roses goes a long way. Take a walk through "The Garden" with Alice Cooper on back up vocals:
Last call! What to close the curtain with???? You all think this is easy, but it is not!
Now understand that I have NO IDEA why this song was stuck in my head most of today, but I do what the voices in my head tell me too (most of the time!). Closing the night with the get up and get crazy fun tune "Let The Music Play" by Shannon:
You gotta get groovy on that one!
Have a good night.
16 comments:
Yes, well, as far as the latest Goldman Sachs scandal goes, Jesse, Yves and Karl have been all over it. As has Mish. My only question is, since when did fraud warrant a civil action?
When there are criminal prosecutions, I'll be impressed.
Oh, wait, that's right. The banks paid off the politicians to change the law so no crime was committed. Never mind.
Barry Ritholtz has begun to really annoy me as well. While some might think I tried to defend him the other day, actually I was defending his position as an agent. It's a fine distinction, I know, but a notable one.
Howbeit, I believe he's gone off the deep end. Maybe it's the impending market crash, which he must know full well is coming, if he has a brain, that will cause his clients to lose millions, that's keeping him up at nights, sweating. I don't know or care. But when he used his lame blog to trash the TEA Party movement, with which I am not affiliated with but respect as a natural-born American right to protest, I deleted it off my list of favorites.
Anyway, so, you still haven't gotten over Jethro Tull winning that Grammy? Doesn't detract from the quality of his music. I notice that Metallica was given a Grammy the next year for the same album, which technically should have been ineligible for consideration. That was cheap, if you ask me.
Black Sabbath never won a Grammy. Although I can think of at least four rock solid albums that deserved one. If they had been nominated and lost, you wouldn't have seen them throw a hissy fit about it.
Kiss won a Grammy, but it was for a hit single. They're also the only band to tie the record for most gold albums set by, well, you know.
The Band That Shall Remain Unnamed never won a Grammy, but they sold more albums than any other group.
Get over it. Appreciate the music.
Thanks GYSC,
Layla is one of my personal top ten songs.
I remember being about 8 or 9 years old and hearing that song on the radio, even at that young of an age it was like I had an epiphany of just how good music could be.
Oh yeah, it was in 'Goodfellas' too : )
One more thing:
GYSC, did you get your fishing kayak yet, or did you decide against it?
Gawains,
I agreed with your response on Barry as an agent but I still think your position was more up front than his. His hit job on the Diana Olick story was straight up off the wall and I wonder if he needs to unload a huge long futures spot or needs more investors. Puzzling. As far as the music goes I have my issues and bias, I do my best!
Watchtower,
I love Clapton and "Layla" is 2nd to "Cocaine" for me.
I bought the kayak! The wife gave me a free pass for Christmas on bass pro shops for $1k and I got:
-FS-10 kayak
-Floatation vest
-Paddle
-anchor rig
-free set depth finder
-Senkos by the dozen
-Gamakatsu octopus hooks
-Berkely Transoptic line
-Berkley Fireline
-a bunch of lures
-I still had $100 to go.
Cannot wait! When I get back from the Bahamas it is fishing time!
Please send pictures of the ladies dancing to "Let the Music Play"; email at the left, HA!
i always thought that strategic default spending was AWFULLY anecdotal, but i had a very smart retail guy site it to me this week as a reason that retailers were performing so well, which surprised me. that doesn't mean it's true, but it's gained traction far beyond a few anecdotes, somehow.
KD,
me too!
I thought it was crap, but after some number running it deserves a fair shake. Too bad you are brainless and too dumb to read numbers like Barry can. Off to online poker HA!
KD, and others (where is Lisa???) I offer a full night out with simple accomodations if you would like to trade jabs over dinner. Let me know!
No takers? I would think the maestros of the world coul pay someody to do the puzzle.
2 ounces of silver for the winner.
Awesome version of Layla! But as for Let the Music Play... let's just say some things from the 80s are better left in the past :)
I'm going to work on those DNA codes tomorrow! I love word puzzles.
Historically, consumer spending has rarely gone down during recessions. I'm pretty sure it's because of the way GDP is calculated.
For example, real estate is a huge % of the economy. It's most people's biggest expense and their lives revolve around that choice.
When house prices increase, more people start investing in their houses and a lot of consumer money goes into the private fixed investment category.
Now that real estate has slowed down, a lot of people who've been fixing up their houses have probably decided to go on trips, go to restautants or buy new clothes instead of putting more money in a depreciating asset.
So you'll notice private fixed investments in the dumps and consumer spending holding up.
On top of that, you get people not paying their mortgage and many getting UI.
Another factor that nobody talks about is the savings factor.
Imagine you are a 50 year-old boomer saving 5 to to 10K per year but only had 150-250K in your retirement portfolio. You probably took a huge hit in your investment portfolio and now your house is not going to help you retire. In fact, chances are it's not under water but you probably still have a 50-100K mortgage on the beast.
The reality that they will never retire has probably just sunk in. They have a financial cushion to protect themselves from hardships but not enough to retire. So why bother saving? Friends and family around them are probasbly starting to get sick and they're saying what the heck, may as well enjoy the future years instead of saving 5-10K per year when we still won't be able to retire.
I know there are a lot of boomers in that situation but try and find the data!
Sometimes you've just got to take a leap of faith.
As for Dear Barry:
2 beefs:
Not long ago, he was a Goldman cheerleader. I noticed that over time his stance has been changing and he's been making it look as if he never was a true supporter. Revisionist history? The next few posts should be revealing...
He's always maintained that there was no real estate bubble but a credit bubble. Instead, he called it a soufflé. A few weeks ago, he actually wrote real estate bubble in one of his posts but then a few posts later, he had a post specifically explaining his no real estate bubble stance. His posturing based on semantics drives me batty!
But apart from that he does fine work and seems to be a good guy. We all have our hangups and I forgive him for his!
Soleil,
No one has submitted a solution as yet, good luck! Are you saying you did not get up and dance to the last song? Really? Glad you stopped in.
Moneta,
Excellent points re consumer spending. On Barry, I really love the guy it just seems the past two weeks were a little off for him.
I went to look at the GDP numbers once again and here is another thought:
Private fixed investment is down quite a bit but consumer spending is holding up.
I wouldn't be surprised if many small to medium sized companies are holding off on investments but the owners are still cutting themselves a cheque to pay for that lifestyle.
Last summer my dad talked to some business owners at the golf club and quite a few said they kept their cuts to a minimum because the next round of layoffs would mean less time for golf since they'd have to be in the office.
Lifestyles are sticky indeed.
Of course the situation can't go on forever. I guess we'll know the truth in a couple of years.
How is it GYSC and I are near the same age, but for the life of me I dont think I have ever heard "let the music play" nor do I recall "Shannon"?
Anon,
I have no idea, that song is a classsic out at the clubs, well it was back when I used to go to them!
There were 2 correct answers to the DNA puzzle! Usually no one gets them. I will post the solution in a bit.
Post a Comment