Maybe We Should Have Had that Moral Hazard Talk After All

Another week for the history books with more drama than a Danielle Steel novel! I hope this site has helped you stay informed, entertained, and prepared for all that has happened and for that which is to come.

Fraud, Fraud, and then a Side Dish of Fraud
I am becoming numb to the never ending parade of news stories about fraud and a total collapse of ethics. Still, we must pay attention (hat tip Jesse's Cafe):

Merrill review spots trading 'irregularity'
7 Mar 2009, 0047 hrs IST, Bloomberg
LONDON: Merrill Lynch & Co, the securities firm acquired by Bank of America Corp, said it uncovered an “irregularity” during a review of its
trading operations.
The bank informed regulators immediately of the discrepancy in “certain trading positions”, Merrill Lynch said in a statement from London. The bank said it’s working with the authorities to investigate further. A spokeswoman for the bank declined to comment further.
Merrill Lynch may have lost hundreds of millions of dollars on currency trading and credit derivatives last year, the New York Times reported earlier on Thursday.
The losses did not “spill into plain view” until after Bank of America investors had approved the $33 billion takeover in December and Merrill Lynch disbursed $3.6 billion in bonuses to bankers, the newspaper said. Bank of America later sought additional government funding. “Senior managers of the business are focused on the issue and believe the risks surrounding possible losses are under control,” Merrill Lynch said in the statement.

Get some metamucil for this "irregularity"! Looks like another Merrill Lynch sweep-it-under-the rug- play before they were taken over by Bank of America.

Before this is all over I think that the level of fraud and corruption revealed will probably end investor faith in any but the most transparent vehicles. That is a good thing, and it offers a nice way for a new trader business to step in and fill the void. What a mess.

The Song Remains the Same
Writer Yves Smith of Naked Capitalism had a note up today explaining that she is taking a reduced blogging role over the next months to work on a book project. I wish her well and I will be first in line to buy the book!

Yves had a line in her post that struck as very familiar:

"Maybe I am getting burned out from the crisis, but I feel too much of my commentary keeps circling back to the same topics. The problems are not going away, and even if there are new news hooks, the themes aren't changing all that much, the bad policies, the bad assets, the lack of will to reform, the doublespeak. I suppose in times like these, making sure one is not part of the problem and doing what one can, even in a small way, to get things on a better path is a contribution. But the trajectory of policy seems immune to public opinion and reason."

I concur. We discuss to no end the same problems over and over and yet nobody in a position to do something seems to have any clue. We know that the new administration watches CNBC (public words about Santelli and Cramer) so why not read a few blogs? If the FED-Treasury-White House spent 3 hours today on Calculated Risk, Mish's site, and Naked Capitalism they might grow a brain. One can dream.

Also on Naked Capitalism today is a scathing piece that states that the current Treasury head's handling of the Asian Crisis may not have been the "slam dunk" success it was made out to be. Fascinating stuff.

Maybe We Should Have Had that Moral Hazard Talk After All
To me, the most shocking and infuriating event of the current debacle was how in the space of about 2 days there was a move made from starting to think about moral hazard to acceptance that it did not matter. I mean, in 2 days the whole concept of rewarding and propping up total failures was glossed over. To this day I am most disappointed with that shortcoming.

It seems there may be a little bit of regret out there, small as it may be, that moral hazard was ignored. Calculated Risk has extensive excerpts from Kansas City Fed President Thomas Hoenig that are well worth a review.

Key point:

"If an institution’s management has failed the test of the marketplace, these managers should be replaced. They should not be given public funds and then micro-managed, as we are now doing under TARP, with a set of political strings attached."

Welcome to the party Mr. Hoenig!

If nobody is scared to make mistakes because they have a guaranteed backstop, they will behave very differently than if they are on their own. As I have said before, do not cry and moan that the free market has led us to this point, we have not had a free market in some time. The big banks knew it and took full advantage. The FED and the Treasury have been played for suckers, which would be both funny and just fine except the only money they have to waste is OUR MONEY! Thus it is just sad and cruel.

Friday Night Entertainment
A little light on material tonight as it took me a little while to compose and re check tonights DNA based cipher puzzle!

Puzzle Number Two
Last Friday I put up a puzzle that used the DNA bases to translate out into words a message. You may want to review the instructions from last week as they apply to the new puzzle as well.

First off, I will not post a solution until Sunday afternoon, around 5pm. I would ask anyone that gets the puzzle done to refrain from posting a full solution but if you have it done add up the numbers used in the message and post the total in the comments section. This way I can tell who got it first without giving the message away. If you are first, just think of what you would gain:
-You could put the accomplishment on your resume; I would lead with it myself
-You will be the envy of the Economic Disconnect community (all 50 of us!)
-You will be the toast of all your friends and co-workers
With all that on the line, you should all be sharp! On to the instructions:

Last week the DNA started right off by coding for a message. Not so easy this time. The sequence is split into two sections.

Section One
Last week I went over how all genes start with the sequence ATG which codes for amino acid methionine (M). It still applies, but this time there has to be an element known as a Kozak Sequence directly before the ATG. Only a high strength Kozak will start a gene reading. I will not tell you what a Kozak sequence looks like, you will have to find out. Here is the sequence first section and remember the M will not be part of the message:

5'-AAGGAATGACACTCTGGAAATGACAGCACCCG
GATTGGATGCCCTGTACTCCAGCGCGTCTCGGAG
CCACCATGACACATGAGTGGATTAATAACATCA
ATGGTGATATCGGCATAACGTCCGCCAGGGAA-3'

Section Two
Ok, if you got the first section right the second section reads right through, I mean that the first 3 bases of section two are the next letter of the message, no start needed. The new wrinkle here is that I have split up the sequence by intron-exon boundaries. Introns are sections of DNA that are not used in a message, but are interspersed in a gene sequence. The introns are spliced out by enzymes. The intronic regions are notated with small letters instead of CAPS. To complete the second section you must take out the introns to get a complete message. Be careful to reassemble your DNA fragment in frame!:

5'-GAGATTattcgggggcccttttaaacgGGACATACAAACAtgg
ggcccccgtggctTCAAccccaaaattttgggtgtgaatgcTGAAACTGggt
taaggccttaagggcgtAGAATTGAggccttaagcgcgctta-3'

I will of course answer any clarification questions as I know this can be a bit much to take in! Have at it!

Friday Night Rock Blogging
Wow, that took a while to write! On to the music!

Reader Kevin requests a song called "Road to Hell" by Chris Rea and I must say it is a good one! Anyone that plays guitar with a slide is awesome and the song is very thoughtful:


While watching the Oscar winning film "Point Break" I heard a song in the background that I really liked. After some detective work, pleae enjoy L.A. Guns and "Over the Edge":


What do you get if you cross unreal vocals with unreal music and lyrics? You might get "Wheel in the Sky" by "Journey":


Heard this one on the radio on the way home. Complete with old school TV performance of "Turn Me Loose" by "Loverboy":


Last call! Markets have you down? Things are getting scary? Feel like you went 15 rounds in a fight and lost? Well pick yourself up and get back at it, next week. Special inspiration provided by Bill Conti:


Have a good night!