Long Week Comes To an End

This week seemed like it was a month long. So much going on in the world of finance. Super busy at work. I am with Capitalist Preservation in the idea that tonight and this weekend we should all lighten up and have a little fun. Huge snowstorm coming for Us on Sunday and into Monday, so I may even get a 3 day weekend out of the deal!!

Gold Observations
Yesterday I noted the action in gold over the past week seemed forced by short sellers and overall dumping at the 10am market open in New York. Even with this kind of pressure, gold held up well. As I am a computer illiterate and I have only so much time to make a post in a given night, I hardly ever can put together (that rhymed!) charts and all the bells and whistles other writers can. Luckily, if you wait a couple of days someone will do all the heavy lifting for you! This Minyanville article has graphical details on what I was seeing (below is text only):

Short Squeeze for Gold?
Despite yesterday’s decline in the gold price, Gold ETFs' (GLD) gold holdings rose a third of a tonne to just over 1029 tonnes and another new all-time high.
Yesterday, COMEX open interest rose by a touch again on Wednesday -- to 373,339 contracts -- despite the sharp decline in the gold price. Which suggests once again that the decline was primarily the result of more heavy short selling by gold bears - and not bulls closing out longs.
In fact, if we look at the rate of growth in the shares outstanding of the 2x short gold ETFs (DZZ and GLL), you can see the rapid increase in the rate of new shorts that's occurred in just these 2 ETFs over the past couple of weeks.
Both of these ETFs get their 2x short exposure to gold by shorting the metal in the futures market.
Given that the GLD ETF hasn’t sold an ounce during this decline (and actually added a little yesterday), this is the setup for a huge short squeeze wherever this 4-day decline in gold terminates. Yesterday’s dip back to what was the October high and the ensuing reversal to end on the highs may just have signaled we’ve hammered out a low for this decline.

I love gold in a macro sense so I am not too concerned about day to day changes. I wanted to highlight this article because it captured perfectly the action I was seeing.

Another Automatic Earth Thought Provoker
I admit that I look forward to reading the daily missives of the blog Automatic Earth. Today's is a really good one to get you thinking, so you may want to leave it for Monday! Full post here.

Brutal Honesty from the Brits
While I have NEVER understood most British humor, I do admire the honesty and up front manner the Brits do things. It seems that even their elected officials are not immune to telling it like it is! Imagine the concept!

Please consider the following admission:

Mervyn King: 'Impossible to say' how much capital needed to shore up banking system
Mr King said it would take "many months" to establish the scale of toxic assets held by banks, and the scale of problems would change depending on the international economic outlook.
Giving evidence to the Treasury Select Committee, Mr King said it was vital to "find out what is really on the balance sheets of our major banks".
"That is not something that is easy to do or can be done quickly," he told the MPs. "It will require a much longer and more detailed assessment contract by contract."
He went on: "It will certainly take many months in my view."
Mr King said the state of the global economy would have a huge impact on the situation of struggling UK financial institutions.
"How much capital banks will need in the end is impossible to tell," he added

When I write that the bailouts and backstops will have no end, and even that by design they are revolving doors people say "Hey, Economic Disconnect, surely there is an end to the amount that can go into all this stuff!". Mr. King just spelled it out for you. Notice that he did not say "if the banks need capital larger than X, then we will have to seek alternate plans". No he just said there is no way to know how much it will take, but he is ready to give!

From further in the article, check out this line:

"I do think public debt matters. We get to this crisis with levels of public borrowing which were too high and that made it difficult," he said.
But, he added, that was a "million miles" away from the idea that Britain in any way resembled somewhere like Zimbabwe.

A million miles may be closer than you think Mervyn my man!

5'-TTTCGCATTGACGCCTACAACATAGGCCACACCATGATACGGACGCACTGA
The spell checker for Blogger is working. After a week where I looked at literally over one hundred thousand bases during my DNA gene construction efforts I have progressed to the point at which I am seeing letters spelled out DNA bases! Let me explain.

Greatly simplified; three bases of DNA make up what is called a codon for an specific amino acid. These amino acids are strung together to make proteins, these proteins in turn make YOU. As I work at the DNA level the three bases represent a letter that stands for the particular amino acid they call for. There are 4 bases, A,T,G, and C and three of them make an amino acid.

Example: All eukaryotic genes start with the amino acid Methionine. That is every single protein is initiated with a methionine. The DNA bases for methionine are ATG. ATG = methionine. Methionine is designated a single letter code to make notation easier. Methionine has the letter code M. So ATG = M.

What I have done ,because I am a dork, is spell out the header for this section in DNA bases that when translated into their protein letters will give you the title of this section. It is not the title of the overall post (Long Week Comes To an End). If you have time to kill, try to figure it out. If not, I will post a translation tomorrow. Comes in handy as a cipher text as well!

Funny Commercial
When I saw this commercial this afternoon I laughed until my face hurt. It just cracks me up and I HAVE NO IDEA WHY! I am still chuckling:


Where is MY Pony?
Warning; Adult language in this cartoon, click only if you are not going to get offendedWith all the handouts you would think there would be a chicken in every pot, and a pony for every little girl. What happens when you are not one of the bailout winners? Here is your answer.

Star Wars Reference
If you know the scene referenced from Star Wars IV: A New Hope (original film) this picture will be very funny. If you are not familiar with the scene, it may not be funny:


Rock Blogging
Time to kick back, hear some tunes, and start the weekend!

A band I like is the Cranberries. My favorite song is called "Zombie". Haunting vocals, rich and deep baseline, and great lead guitar work all combine for a real treat:

Note: I understand this song has a political undertone to it, I am playing it because I love the song and have no commenatry on the politics it may reference.

I used to love this TV show when I was a lot younger called "Crime Story". The intro song was the timeless hit by Del Shannon "Runaway". Enjoy the song complete with a throwback "music video":


I had this song up a long time ago, but I was in the mood for the greatest Van Halen song ever! Please enjoy Halen at the height of their powers with a truly rock out tune called "Atomic Punk":


By now you all know I am an 80's hair band music addict! Along those lines enjoy White Lion with "Wait":


Last one for the evening. One of CCR's best songs (there are so many) is Green River and thus it will close the show:


Have a good night.